Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Olfr303'

167712

Institutional Source

Beutler Lab

Gene Symbol

Olfr303

Ensembl Gene

ENSMUSG00000039608

Gene Name

olfactory receptor 303

Synonyms

GA_x6K02T2NHDJ-9712819-9713778, MOR104-2

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86391810-86397789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86394812 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 229 (S229P)

Ref Sequence

ENSEMBL: ENSMUSP00000149419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]

AlphaFold

Q8VFP0

Predicted Effect

probably benign
Transcript: ENSMUST00000053958
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: S229P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	1.2e-52	PFAM
Pfam:7tm_1	41	307	4.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215234
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000215532
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000215733
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000216409
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Olfr303

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02228:Olfr303	APN	7	86395078	missense	possibly damaging	0.50
IGL02902:Olfr303	APN	7	86394535	utr 3 prime	probably benign
IGL02937:Olfr303	APN	7	86394590	missense	possibly damaging	0.89
BB001:Olfr303	UTSW	7	86394730	missense	probably damaging	1.00
BB011:Olfr303	UTSW	7	86394730	missense	probably damaging	1.00
R1455:Olfr303	UTSW	7	86394595	missense	probably damaging	0.97
R1762:Olfr303	UTSW	7	86395145	missense	probably damaging	0.97
R3014:Olfr303	UTSW	7	86394676	missense	probably benign	0.19
R3027:Olfr303	UTSW	7	86394553	missense	probably benign	0.00
R4073:Olfr303	UTSW	7	86394947	missense	probably damaging	0.98
R4502:Olfr303	UTSW	7	86395277	missense	possibly damaging	0.49
R4503:Olfr303	UTSW	7	86395277	missense	possibly damaging	0.49
R4607:Olfr303	UTSW	7	86394510	splice site	probably null
R4608:Olfr303	UTSW	7	86394510	splice site	probably null
R7134:Olfr303	UTSW	7	86395544	start gained	probably benign
R7298:Olfr303	UTSW	7	86394923	missense	probably damaging	1.00
R7827:Olfr303	UTSW	7	86394557	nonsense	probably null
R7924:Olfr303	UTSW	7	86394730	missense	probably damaging	1.00
R8160:Olfr303	UTSW	7	86395265	missense	possibly damaging	0.61
R8294:Olfr303	UTSW	7	86395279	missense	probably damaging	1.00
R9465:Olfr303	UTSW	7	86394656	missense	probably benign	0.00
R9725:Olfr303	UTSW	7	86394765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGTAGAACACTGAGACTACTTTGCC -3'
(R):5'- TGTCACAAAGGTTGTCACCATTCCTG -3'

Sequencing Primer
(F):5'- CACTGAGACTACTTTGCCAATTGTG -3'
(R):5'- AGCCACTGAGTGCATCTTG -3'

Posted On

2014-04-13