Incidental Mutation 'R1524:Or6aa1'
ID 167712
Institutional Source Beutler Lab
Gene Symbol Or6aa1
Ensembl Gene ENSMUSG00000039608
Gene Name olfactory receptor family 6 subfamily AA member 1
Synonyms MOR104-2, Olfr303, GA_x6K02T2NHDJ-9712819-9713778
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 86043704-86044743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86044020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000149419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]
AlphaFold Q8VFP0
Predicted Effect probably benign
Transcript: ENSMUST00000053958
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: S229P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-52 PFAM
Pfam:7tm_1 41 307 4.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215234
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215532
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215733
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216409
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Or6aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Or6aa1 APN 7 86,044,286 (GRCm39) missense possibly damaging 0.50
IGL02902:Or6aa1 APN 7 86,043,743 (GRCm39) utr 3 prime probably benign
IGL02937:Or6aa1 APN 7 86,043,798 (GRCm39) missense possibly damaging 0.89
BB001:Or6aa1 UTSW 7 86,043,938 (GRCm39) missense probably damaging 1.00
BB011:Or6aa1 UTSW 7 86,043,938 (GRCm39) missense probably damaging 1.00
R1455:Or6aa1 UTSW 7 86,043,803 (GRCm39) missense probably damaging 0.97
R1762:Or6aa1 UTSW 7 86,044,353 (GRCm39) missense probably damaging 0.97
R3014:Or6aa1 UTSW 7 86,043,884 (GRCm39) missense probably benign 0.19
R3027:Or6aa1 UTSW 7 86,043,761 (GRCm39) missense probably benign 0.00
R4073:Or6aa1 UTSW 7 86,044,155 (GRCm39) missense probably damaging 0.98
R4502:Or6aa1 UTSW 7 86,044,485 (GRCm39) missense possibly damaging 0.49
R4503:Or6aa1 UTSW 7 86,044,485 (GRCm39) missense possibly damaging 0.49
R4607:Or6aa1 UTSW 7 86,043,718 (GRCm39) splice site probably null
R4608:Or6aa1 UTSW 7 86,043,718 (GRCm39) splice site probably null
R7134:Or6aa1 UTSW 7 86,044,752 (GRCm39) start gained probably benign
R7298:Or6aa1 UTSW 7 86,044,131 (GRCm39) missense probably damaging 1.00
R7827:Or6aa1 UTSW 7 86,043,765 (GRCm39) nonsense probably null
R7924:Or6aa1 UTSW 7 86,043,938 (GRCm39) missense probably damaging 1.00
R8160:Or6aa1 UTSW 7 86,044,473 (GRCm39) missense possibly damaging 0.61
R8294:Or6aa1 UTSW 7 86,044,487 (GRCm39) missense probably damaging 1.00
R9465:Or6aa1 UTSW 7 86,043,864 (GRCm39) missense probably benign 0.00
R9725:Or6aa1 UTSW 7 86,043,973 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCAGTAGAACACTGAGACTACTTTGCC -3'
(R):5'- TGTCACAAAGGTTGTCACCATTCCTG -3'

Sequencing Primer
(F):5'- CACTGAGACTACTTTGCCAATTGTG -3'
(R):5'- AGCCACTGAGTGCATCTTG -3'
Posted On 2014-04-13