Incidental Mutation 'R1524:Olfr303'
ID167712
Institutional Source Beutler Lab
Gene Symbol Olfr303
Ensembl Gene ENSMUSG00000039608
Gene Nameolfactory receptor 303
SynonymsGA_x6K02T2NHDJ-9712819-9713778, MOR104-2
MMRRC Submission 039565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86391810-86397789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86394812 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000149419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053958] [ENSMUST00000215234] [ENSMUST00000215532] [ENSMUST00000215733] [ENSMUST00000216409]
Predicted Effect probably benign
Transcript: ENSMUST00000053958
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000062459
Gene: ENSMUSG00000039608
AA Change: S229P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-52 PFAM
Pfam:7tm_1 41 307 4.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215234
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215532
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000215733
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216409
AA Change: S229P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Olfr303
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02228:Olfr303 APN 7 86395078 missense possibly damaging 0.50
IGL02902:Olfr303 APN 7 86394535 utr 3 prime probably benign
IGL02937:Olfr303 APN 7 86394590 missense possibly damaging 0.89
R1455:Olfr303 UTSW 7 86394595 missense probably damaging 0.97
R1762:Olfr303 UTSW 7 86395145 missense probably damaging 0.97
R3014:Olfr303 UTSW 7 86394676 missense probably benign 0.19
R3027:Olfr303 UTSW 7 86394553 missense probably benign 0.00
R4073:Olfr303 UTSW 7 86394947 missense probably damaging 0.98
R4502:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4503:Olfr303 UTSW 7 86395277 missense possibly damaging 0.49
R4607:Olfr303 UTSW 7 86394510 utr 3 prime probably null
R4608:Olfr303 UTSW 7 86394510 utr 3 prime probably null
R7134:Olfr303 UTSW 7 86395544 start gained probably benign
R7298:Olfr303 UTSW 7 86394923 missense probably damaging 1.00
R7827:Olfr303 UTSW 7 86394557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTAGAACACTGAGACTACTTTGCC -3'
(R):5'- TGTCACAAAGGTTGTCACCATTCCTG -3'

Sequencing Primer
(F):5'- CACTGAGACTACTTTGCCAATTGTG -3'
(R):5'- AGCCACTGAGTGCATCTTG -3'
Posted On2014-04-13