Incidental Mutation 'R1524:Slc5a5'
ID 167719
Institutional Source Beutler Lab
Gene Symbol Slc5a5
Ensembl Gene ENSMUSG00000000792
Gene Name solute carrier family 5 (sodium iodide symporter), member 5
Synonyms NIS
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1524 (G1)
Quality Score 194
Status Validated
Chromosome 8
Chromosomal Location 71335533-71345401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 71344978 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 110 (Y110D)
Ref Sequence ENSEMBL: ENSMUSP00000000809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000809] [ENSMUST00000054220] [ENSMUST00000212129] [ENSMUST00000212709] [ENSMUST00000212378] [ENSMUST00000212494] [ENSMUST00000213053] [ENSMUST00000212796]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000809
AA Change: Y110D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: Y110D

DomainStartEndE-ValueType
Pfam:SSF 47 452 2.5e-43 PFAM
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054220
SMART Domains Protein: ENSMUSP00000058368
Gene: ENSMUSG00000045128

DomainStartEndE-ValueType
Pfam:Ribosomal_L18ae 7 130 1.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212019
Predicted Effect probably benign
Transcript: ENSMUST00000212129
Predicted Effect probably benign
Transcript: ENSMUST00000212709
Predicted Effect probably benign
Transcript: ENSMUST00000212378
Predicted Effect probably benign
Transcript: ENSMUST00000212494
Predicted Effect probably benign
Transcript: ENSMUST00000213053
Predicted Effect probably benign
Transcript: ENSMUST00000212796
Meta Mutation Damage Score 0.7422 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Slc5a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Slc5a5 APN 8 71,341,181 (GRCm39) missense probably damaging 0.99
IGL01372:Slc5a5 APN 8 71,343,020 (GRCm39) unclassified probably benign
IGL01394:Slc5a5 APN 8 71,342,032 (GRCm39) nonsense probably null
IGL01571:Slc5a5 APN 8 71,343,976 (GRCm39) unclassified probably benign
IGL02043:Slc5a5 APN 8 71,345,073 (GRCm39) missense possibly damaging 0.84
IGL02186:Slc5a5 APN 8 71,338,764 (GRCm39) missense possibly damaging 0.79
IGL02479:Slc5a5 APN 8 71,341,555 (GRCm39) missense possibly damaging 0.67
IGL02559:Slc5a5 APN 8 71,342,915 (GRCm39) missense probably damaging 1.00
IGL02892:Slc5a5 APN 8 71,345,161 (GRCm39) missense probably damaging 1.00
IGL03388:Slc5a5 APN 8 71,342,972 (GRCm39) missense probably benign 0.45
R0234:Slc5a5 UTSW 8 71,342,277 (GRCm39) missense probably damaging 1.00
R0234:Slc5a5 UTSW 8 71,342,277 (GRCm39) missense probably damaging 1.00
R0413:Slc5a5 UTSW 8 71,344,319 (GRCm39) missense possibly damaging 0.63
R0662:Slc5a5 UTSW 8 71,336,519 (GRCm39) missense probably benign 0.01
R0781:Slc5a5 UTSW 8 71,342,864 (GRCm39) missense probably benign 0.19
R1061:Slc5a5 UTSW 8 71,342,865 (GRCm39) missense probably benign 0.00
R1400:Slc5a5 UTSW 8 71,342,079 (GRCm39) missense possibly damaging 0.87
R2033:Slc5a5 UTSW 8 71,341,231 (GRCm39) missense probably damaging 0.99
R2072:Slc5a5 UTSW 8 71,345,083 (GRCm39) missense possibly damaging 0.95
R2075:Slc5a5 UTSW 8 71,345,083 (GRCm39) missense possibly damaging 0.95
R2110:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2111:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2112:Slc5a5 UTSW 8 71,342,395 (GRCm39) splice site probably null
R2201:Slc5a5 UTSW 8 71,345,102 (GRCm39) missense probably damaging 0.98
R3978:Slc5a5 UTSW 8 71,342,039 (GRCm39) missense probably benign 0.00
R4244:Slc5a5 UTSW 8 71,342,930 (GRCm39) missense probably benign
R5161:Slc5a5 UTSW 8 71,341,492 (GRCm39) missense probably damaging 1.00
R5397:Slc5a5 UTSW 8 71,343,823 (GRCm39) missense probably damaging 1.00
R5718:Slc5a5 UTSW 8 71,340,399 (GRCm39) missense probably benign 0.00
R5740:Slc5a5 UTSW 8 71,341,561 (GRCm39) splice site probably null
R5869:Slc5a5 UTSW 8 71,344,974 (GRCm39) missense probably damaging 1.00
R6268:Slc5a5 UTSW 8 71,341,264 (GRCm39) missense probably damaging 1.00
R6290:Slc5a5 UTSW 8 71,343,822 (GRCm39) missense probably damaging 1.00
R6292:Slc5a5 UTSW 8 71,343,822 (GRCm39) missense probably damaging 1.00
R7098:Slc5a5 UTSW 8 71,341,182 (GRCm39) missense probably damaging 0.99
R7354:Slc5a5 UTSW 8 71,342,247 (GRCm39) missense probably damaging 1.00
R8777:Slc5a5 UTSW 8 71,343,934 (GRCm39) missense possibly damaging 0.87
R8777-TAIL:Slc5a5 UTSW 8 71,343,934 (GRCm39) missense possibly damaging 0.87
R8903:Slc5a5 UTSW 8 71,345,227 (GRCm39) missense probably damaging 1.00
R9474:Slc5a5 UTSW 8 71,337,596 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTTTGGGAAATCCTACACCTCACTG -3'
(R):5'- AGCGCCGACGACTTCTTCAC -3'

Sequencing Primer
(F):5'- TTGAACTCTGTCGGGCG -3'
(R):5'- ACGACTTCTTCACCGGGG -3'
Posted On 2014-04-13