Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Sin3b'

167720

Institutional Source

Beutler Lab

Gene Symbol

Sin3b

Ensembl Gene

ENSMUSG00000031622

Gene Name

transcriptional regulator, SIN3B (yeast)

Synonyms

2810430C10Rik

MMRRC Submission

039565-MU

Accession Numbers

Genbank: NM_009188, NM_001113248; MGI: 107158

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72723285-72758201 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 72753287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 874 (T874A)

Ref Sequence

ENSEMBL: ENSMUSP00000004494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004494]

AlphaFold

Q62141

PDB Structure

STRUCTURE OF THE COMPLEX OF THE MAD1-SIN3B INTERACTION DOMAINS [SOLUTION NMR]
Extended SID of Mad1 bound to the PAH2 domain of mSin3B [SOLUTION NMR]
Solution structure of the first PAH domain of the mouse transcriptional repressor SIN3B [SOLUTION NMR]
Solution structure of the NRSF/REST-mSin3B PAH1 complex [SOLUTION NMR]
Solution structure of free PAH2 domain of mSin3B [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000004494
AA Change: T874A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000004494
Gene: ENSMUSG00000031622
AA Change: T874A

Domain	Start	End	E-Value	Type
low complexity region	5	26	N/A	INTRINSIC
Pfam:PAH	53	97	2.5e-19	PFAM
Pfam:PAH	173	227	4.4e-20	PFAM
Pfam:PAH	313	357	1.6e-8	PFAM
HDAC_interact	384	484	2.75e-58	SMART
low complexity region	667	688	N/A	INTRINSIC
Pfam:Sin3a_C	712	1011	7.2e-81	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212256

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212677

Meta Mutation Damage Score

0.0592

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

PHENOTYPE: Homozygous null mice fail to survive past P1 and exhibit pallor, fetal growth retardation, impaired terminal differentiation of erythrocytes and granulocytes, a pale liver and reduced ossification of the long bones in the hindlimb. Mutant MEFs show impaired G0 arrest upon serum deprivation. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Targeted, knock-out(1) Targeted, other(4) Gene trapped(3)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Sin3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Sin3b	APN	8	72757000	missense	probably benign	0.22
IGL01107:Sin3b	APN	8	72731105	missense	possibly damaging	0.74
IGL01114:Sin3b	APN	8	72744505	missense	probably benign	0.06
IGL01603:Sin3b	APN	8	72750064	missense	probably damaging	1.00
IGL01763:Sin3b	APN	8	72746608	missense	probably damaging	1.00
IGL02078:Sin3b	APN	8	72753580	missense	possibly damaging	0.49
IGL02572:Sin3b	APN	8	72744481	missense	probably benign	0.15
IGL02732:Sin3b	APN	8	72733453	missense	possibly damaging	0.72
IGL02831:Sin3b	APN	8	72744562	missense	probably damaging	1.00
IGL03064:Sin3b	APN	8	72757058	unclassified	probably benign
IGL03107:Sin3b	APN	8	72753585	missense	probably damaging	0.99
IGL03142:Sin3b	APN	8	72744568	missense	probably damaging	1.00
3-1:Sin3b	UTSW	8	72753209	missense	possibly damaging	0.95
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0070:Sin3b	UTSW	8	72725582	missense	probably damaging	1.00
R0226:Sin3b	UTSW	8	72744508	missense	probably benign	0.44
R0629:Sin3b	UTSW	8	72753536	splice site	probably benign
R1486:Sin3b	UTSW	8	72750513	missense	probably benign	0.00
R1653:Sin3b	UTSW	8	72741519	missense	probably benign	0.30
R2144:Sin3b	UTSW	8	72731265	missense	probably damaging	1.00
R2180:Sin3b	UTSW	8	72753295	nonsense	probably null
R2271:Sin3b	UTSW	8	72733419	missense	probably benign	0.11
R2353:Sin3b	UTSW	8	72724152	critical splice donor site	probably null
R3945:Sin3b	UTSW	8	72733439	missense	possibly damaging	0.88
R4412:Sin3b	UTSW	8	72739779	missense	probably benign	0.16
R4564:Sin3b	UTSW	8	72753581	missense	probably damaging	1.00
R4782:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4799:Sin3b	UTSW	8	72725643	missense	probably benign	0.04
R4863:Sin3b	UTSW	8	72744948	missense	possibly damaging	0.91
R5011:Sin3b	UTSW	8	72744556	missense	probably benign	0.39
R5237:Sin3b	UTSW	8	72733343	critical splice acceptor site	probably null
R5325:Sin3b	UTSW	8	72750526	missense	probably damaging	1.00
R5725:Sin3b	UTSW	8	72725692	critical splice donor site	probably null
R5927:Sin3b	UTSW	8	72749878	missense	probably benign	0.00
R5945:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97
R6492:Sin3b	UTSW	8	72733490	critical splice donor site	probably null
R7092:Sin3b	UTSW	8	72747870	critical splice donor site	probably null
R7106:Sin3b	UTSW	8	72724137	missense	possibly damaging	0.90
R7258:Sin3b	UTSW	8	72750208	missense	probably benign	0.00
R7472:Sin3b	UTSW	8	72753225	missense	probably damaging	1.00
R7475:Sin3b	UTSW	8	72749872	missense	possibly damaging	0.47
R7491:Sin3b	UTSW	8	72746441	missense	probably damaging	1.00
R7636:Sin3b	UTSW	8	72747734	nonsense	probably null
R8063:Sin3b	UTSW	8	72725541	missense	probably damaging	1.00
R8354:Sin3b	UTSW	8	72741480	missense	probably benign
R8454:Sin3b	UTSW	8	72741480	missense	probably benign
R8711:Sin3b	UTSW	8	72723398	missense	probably damaging	0.97
R8719:Sin3b	UTSW	8	72723511	missense	unknown
R8807:Sin3b	UTSW	8	72750080	missense	probably benign	0.00
R8857:Sin3b	UTSW	8	72756895	missense	probably benign
R8924:Sin3b	UTSW	8	72746503	missense	probably benign	0.05
R9035:Sin3b	UTSW	8	72723464	missense	unknown
R9127:Sin3b	UTSW	8	72733406	missense	possibly damaging	0.70
R9272:Sin3b	UTSW	8	72744540	missense	probably benign	0.02
R9455:Sin3b	UTSW	8	72724053	missense	possibly damaging	0.56
R9641:Sin3b	UTSW	8	72750559	missense	probably damaging	1.00
X0017:Sin3b	UTSW	8	72731165	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GTATAAGCGTCTTCAGGGATGGCAG -3'
(R):5'- TGTAGAGGACAGGAACAGACTCACC -3'

Sequencing Primer
(F):5'- TGTACCTGAATGAGCAGCAG -3'
(R):5'- ATGGTCTGAGCTGCCATCAATC -3'

Posted On

2014-04-13