Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Ces5a'

167721

Institutional Source

Beutler Lab

Gene Symbol

Ces5a

Ensembl Gene

ENSMUSG00000058019

Gene Name

carboxylesterase 5A

Synonyms

Ces7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93499064-93535830 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 93525665 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 200 (F200I)

Ref Sequence

ENSEMBL: ENSMUSP00000148373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009] [ENSMUST00000212722]

AlphaFold

Q6AW46

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077816
AA Change: F196I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: F196I

Domain	Start	End	E-Value	Type
Pfam:COesterase	10	539	3.2e-157	PFAM
Pfam:Abhydrolase_3	141	238	9.5e-7	PFAM
low complexity region	552	575	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212009
AA Change: F196I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212722
AA Change: F200I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

Meta Mutation Damage Score

0.3268

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Ces5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Ces5a	APN	8	93525544	critical splice donor site	probably null
IGL01520:Ces5a	APN	8	93519578	missense	probably benign	0.08
IGL01674:Ces5a	APN	8	93502219	missense	probably damaging	1.00
IGL02257:Ces5a	APN	8	93525598	missense	probably benign	0.00
IGL02456:Ces5a	APN	8	93528644	splice site	probably benign
IGL03027:Ces5a	APN	8	93523114	splice site	probably null
IGL03051:Ces5a	APN	8	93528598	missense	probably damaging	1.00
IGL03264:Ces5a	APN	8	93502270	missense	possibly damaging	0.74
IGL03290:Ces5a	APN	8	93519632	missense	probably damaging	1.00
R0115:Ces5a	UTSW	8	93502183	missense	probably damaging	0.98
R0124:Ces5a	UTSW	8	93528555	missense	probably damaging	1.00
R0521:Ces5a	UTSW	8	93525658	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1404:Ces5a	UTSW	8	93502181	missense	probably damaging	1.00
R1843:Ces5a	UTSW	8	93514231	missense	probably damaging	1.00
R2029:Ces5a	UTSW	8	93534577	missense	probably damaging	1.00
R2135:Ces5a	UTSW	8	93499741	missense	probably benign	0.33
R2146:Ces5a	UTSW	8	93534699	missense	probably benign	0.03
R2973:Ces5a	UTSW	8	93528504	missense	probably damaging	1.00
R3755:Ces5a	UTSW	8	93528502	missense	probably benign	0.15
R4755:Ces5a	UTSW	8	93535677	missense	probably benign	0.39
R5072:Ces5a	UTSW	8	93534668	missense	probably damaging	1.00
R5278:Ces5a	UTSW	8	93525638	missense	probably damaging	1.00
R5419:Ces5a	UTSW	8	93499431	missense	unknown
R5825:Ces5a	UTSW	8	93525667	missense	probably damaging	1.00
R6318:Ces5a	UTSW	8	93534583	missense	probably damaging	1.00
R6925:Ces5a	UTSW	8	93523057	splice site	probably null
R6950:Ces5a	UTSW	8	93530774	missense	probably benign	0.10
R7148:Ces5a	UTSW	8	93502322	missense	probably damaging	1.00
R7256:Ces5a	UTSW	8	93499526	missense	probably benign	0.13
R7290:Ces5a	UTSW	8	93534683	missense	probably damaging	1.00
R7459:Ces5a	UTSW	8	93535741	start gained	probably benign
R7674:Ces5a	UTSW	8	93514269	missense	probably damaging	1.00
R7815:Ces5a	UTSW	8	93520995	missense	possibly damaging	0.79
R8150:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
R8771:Ces5a	UTSW	8	93528621	missense	possibly damaging	0.85
R9502:Ces5a	UTSW	8	93535680	nonsense	probably null
R9518:Ces5a	UTSW	8	93530802	missense	probably damaging	1.00
R9745:Ces5a	UTSW	8	93502186	missense	probably damaging	0.97
X0024:Ces5a	UTSW	8	93514213	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTATTCAACACAAGGGCACCAGC -3'
(R):5'- GCTTGGCTCAAGAGGCAGAGATAAC -3'

Sequencing Primer
(F):5'- CAGCCAAATGTAGATGATGTGTCTTG -3'
(R):5'- GCACTTCTCTTAAAGTCAGAGC -3'

Posted On

2014-04-13