Incidental Mutation 'R1524:Pde4a'
ID167724
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
MMRRC Submission 039565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21201247 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 240 (S240P)
Ref Sequence ENSEMBL: ENSMUSP00000111118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably benign
Transcript: ENSMUST00000003395
AA Change: S63P

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177
AA Change: S63P

DomainStartEndE-ValueType
low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039413
AA Change: S297P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: S297P

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115458
AA Change: S240P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: S240P

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131769
Meta Mutation Damage Score 0.0981 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0257:Pde4a UTSW 9 21192421 missense probably damaging 1.00
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8133:Pde4a UTSW 9 21191377 missense possibly damaging 0.87
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCAGAACAGAGAAGAGCATTCC -3'
(R):5'- TGGGTTACATGAGCCCCAAAGC -3'

Sequencing Primer
(F):5'- GATGGCCTCATAGCAAGTGA -3'
(R):5'- CCTACACCTACTTGTGCTAAGAGG -3'
Posted On2014-04-13