Incidental Mutation 'R1524:Fam161a'
ID167729
Institutional Source Beutler Lab
Gene Symbol Fam161a
Ensembl Gene ENSMUSG00000049811
Gene Namefamily with sequence similarity 161, member A
Synonyms4930430E16Rik
MMRRC Submission 039565-MU
Accession Numbers

Genbank: NM_028672; MGI: 1921123

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1524 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23007531-23030788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23015826 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 40 (N40D)
Ref Sequence ENSEMBL: ENSMUSP00000134485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058269] [ENSMUST00000109557] [ENSMUST00000151877] [ENSMUST00000172602] [ENSMUST00000173923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058269
AA Change: N40D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000063091
Gene: ENSMUSG00000049811
AA Change: N40D

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094363
SMART Domains Protein: ENSMUSP00000091923
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 136 3.6e-15 PFAM
low complexity region 181 202 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109557
AA Change: N40D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105184
Gene: ENSMUSG00000049811
AA Change: N40D

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 350 8.1e-36 PFAM
low complexity region 396 417 N/A INTRINSIC
coiled coil region 437 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151877
SMART Domains Protein: ENSMUSP00000121167
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
Pfam:UPF0564 1 263 2.2e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172602
AA Change: N40D

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134485
Gene: ENSMUSG00000049811
AA Change: N40D

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000173923
AA Change: N40D

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133293
Gene: ENSMUSG00000049811
AA Change: N40D

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208732
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the FAM161 family. It is expressed mainly in the retina. Mouse studies suggested that this gene is involved in development of retinal progenitors during embryogenesis, and that its activity is restricted to mature photoreceptors after birth. Mutations in this gene cause autosomal recessive retinitis pigmentosa-28. Alternatively spliced transcript variants have been identified.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show early loss of visual function associated with alterations in photoreceptor ciliary structure, abnormal photoreceptor outer segment morphology, microgliosis, and progressive retinal photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1466 T A 19: 13,342,122 C121* probably null Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Fam161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Fam161a APN 11 23015894 unclassified probably benign
IGL01457:Fam161a APN 11 23020702 nonsense probably null
IGL01823:Fam161a APN 11 23015785 missense probably damaging 1.00
IGL02111:Fam161a APN 11 23020026 missense probably benign 0.05
3-1:Fam161a UTSW 11 23023429 critical splice acceptor site probably null
R0531:Fam161a UTSW 11 23020298 missense possibly damaging 0.49
R1550:Fam161a UTSW 11 23020470 missense possibly damaging 0.58
R1599:Fam161a UTSW 11 23021093 missense probably benign 0.43
R3744:Fam161a UTSW 11 23020410 missense probably damaging 1.00
R3962:Fam161a UTSW 11 23023507 missense possibly damaging 0.82
R4352:Fam161a UTSW 11 23020798 missense possibly damaging 0.90
R4607:Fam161a UTSW 11 23020710 missense probably benign 0.03
R4820:Fam161a UTSW 11 23020076 missense probably damaging 1.00
R5057:Fam161a UTSW 11 23020397 missense probably damaging 1.00
R5207:Fam161a UTSW 11 23020583 nonsense probably null
R5645:Fam161a UTSW 11 23015725 missense probably damaging 1.00
R5705:Fam161a UTSW 11 23028869 missense unknown
R7107:Fam161a UTSW 11 23023452 missense possibly damaging 0.84
R7203:Fam161a UTSW 11 23021664 splice site probably null
R7242:Fam161a UTSW 11 23020037 missense possibly damaging 0.81
R7286:Fam161a UTSW 11 23020001 missense possibly damaging 0.58
R7483:Fam161a UTSW 11 23021006 missense probably damaging 0.99
R8027:Fam161a UTSW 11 23020125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGGTTCTCTTCACATCAGGCAG -3'
(R):5'- AAGATCATGTTTCAAAATTGGGCCAGC -3'

Sequencing Primer
(F):5'- TCACATCAGGCAGGTTGTCAC -3'
(R):5'- gacatacacacaagcaaaacac -3'
Posted On2014-04-13