Incidental Mutation 'R1524:Pnpt1'
ID 167730
Institutional Source Beutler Lab
Gene Symbol Pnpt1
Ensembl Gene ENSMUSG00000020464
Gene Name polyribonucleotide nucleotidyltransferase 1
Synonyms 1200003F12Rik, polynucleotide phosphorylase, PNPase
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1524 (G1)
Quality Score 178
Status Validated
Chromosome 11
Chromosomal Location 29080744-29111828 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 29080776 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 7 (C7S)
Ref Sequence ENSEMBL: ENSMUSP00000020756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020756]
AlphaFold Q8K1R3
PDB Structure Solution structure of the alpha-helical domain from mouse hypothetical PNPase [SOLUTION NMR]
Predicted Effect unknown
Transcript: ENSMUST00000020756
AA Change: C7S
SMART Domains Protein: ENSMUSP00000020756
Gene: ENSMUSG00000020464
AA Change: C7S

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
Pfam:RNase_PH 52 183 1.9e-16 PFAM
Pfam:RNase_PH_C 186 251 3.8e-13 PFAM
Pfam:PNPase 282 363 3.7e-9 PFAM
Pfam:RNase_PH 366 501 3.4e-22 PFAM
Pfam:RNase_PH_C 504 581 7.1e-6 PFAM
KH 604 669 8e-7 SMART
S1 677 750 2.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154924
Meta Mutation Damage Score 0.4527 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved polynucleotide phosphorylase family comprised of phosphate dependent 3'-to-5' exoribonucleases implicated in RNA processing and degradation. This enzyme is predominantly localized in the mitochondrial intermembrane space and is involved in import of RNA to mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency-13 and autosomal recessive nonsyndromic deafness-70. Related pseudogenes are found on chromosomes 3 and 7. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality and impaired mitochondrial RNA import. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Pnpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pnpt1 APN 11 29,104,217 (GRCm39) critical splice donor site probably null
IGL00920:Pnpt1 APN 11 29,107,087 (GRCm39) splice site probably benign
IGL01358:Pnpt1 APN 11 29,088,425 (GRCm39) missense possibly damaging 0.95
IGL01454:Pnpt1 APN 11 29,087,142 (GRCm39) missense probably benign 0.19
IGL01622:Pnpt1 APN 11 29,098,272 (GRCm39) splice site probably benign
IGL01623:Pnpt1 APN 11 29,098,272 (GRCm39) splice site probably benign
IGL01674:Pnpt1 APN 11 29,105,787 (GRCm39) missense probably benign 0.00
IGL01802:Pnpt1 APN 11 29,104,306 (GRCm39) missense probably damaging 1.00
IGL02222:Pnpt1 APN 11 29,080,842 (GRCm39) missense probably benign 0.00
IGL02222:Pnpt1 APN 11 29,109,327 (GRCm39) missense possibly damaging 0.71
IGL02616:Pnpt1 APN 11 29,085,505 (GRCm39) splice site probably benign
IGL02859:Pnpt1 APN 11 29,088,162 (GRCm39) missense probably damaging 1.00
IGL02965:Pnpt1 APN 11 29,106,939 (GRCm39) missense probably damaging 0.98
IGL03121:Pnpt1 APN 11 29,082,845 (GRCm39) missense probably benign 0.03
PIT4651001:Pnpt1 UTSW 11 29,106,945 (GRCm39) critical splice donor site probably null
R1023:Pnpt1 UTSW 11 29,091,328 (GRCm39) splice site probably benign
R1477:Pnpt1 UTSW 11 29,087,102 (GRCm39) missense probably benign 0.14
R1769:Pnpt1 UTSW 11 29,104,159 (GRCm39) missense probably benign 0.22
R1839:Pnpt1 UTSW 11 29,104,342 (GRCm39) missense possibly damaging 0.82
R1975:Pnpt1 UTSW 11 29,091,256 (GRCm39) missense probably benign 0.16
R1977:Pnpt1 UTSW 11 29,091,256 (GRCm39) missense probably benign 0.16
R1996:Pnpt1 UTSW 11 29,091,679 (GRCm39) missense probably benign 0.01
R3771:Pnpt1 UTSW 11 29,088,174 (GRCm39) missense probably benign 0.05
R4346:Pnpt1 UTSW 11 29,095,478 (GRCm39) missense probably damaging 1.00
R4423:Pnpt1 UTSW 11 29,103,375 (GRCm39) splice site probably null
R5354:Pnpt1 UTSW 11 29,104,166 (GRCm39) missense probably damaging 1.00
R5503:Pnpt1 UTSW 11 29,088,156 (GRCm39) missense probably damaging 1.00
R5514:Pnpt1 UTSW 11 29,103,246 (GRCm39) missense possibly damaging 0.82
R5908:Pnpt1 UTSW 11 29,080,887 (GRCm39) missense probably benign 0.00
R6225:Pnpt1 UTSW 11 29,095,469 (GRCm39) missense probably benign 0.38
R6605:Pnpt1 UTSW 11 29,088,567 (GRCm39) missense possibly damaging 0.69
R7096:Pnpt1 UTSW 11 29,104,867 (GRCm39) missense probably benign 0.03
R7214:Pnpt1 UTSW 11 29,087,285 (GRCm39) missense probably damaging 1.00
R7365:Pnpt1 UTSW 11 29,111,334 (GRCm39) missense probably damaging 1.00
R7492:Pnpt1 UTSW 11 29,085,522 (GRCm39) missense probably benign 0.01
R7497:Pnpt1 UTSW 11 29,080,860 (GRCm39) missense probably benign 0.00
R7686:Pnpt1 UTSW 11 29,107,070 (GRCm39) missense probably damaging 0.97
R8166:Pnpt1 UTSW 11 29,106,875 (GRCm39) missense probably benign
R8309:Pnpt1 UTSW 11 29,103,277 (GRCm39) missense probably benign 0.01
R8389:Pnpt1 UTSW 11 29,080,758 (GRCm39) start codon destroyed unknown
R8542:Pnpt1 UTSW 11 29,082,773 (GRCm39) splice site probably null
R8737:Pnpt1 UTSW 11 29,104,815 (GRCm39) critical splice acceptor site probably null
R8876:Pnpt1 UTSW 11 29,096,769 (GRCm39) intron probably benign
R9308:Pnpt1 UTSW 11 29,097,535 (GRCm39) critical splice donor site probably null
R9545:Pnpt1 UTSW 11 29,106,840 (GRCm39) missense probably benign 0.13
Z1176:Pnpt1 UTSW 11 29,095,477 (GRCm39) missense possibly damaging 0.80
Z1176:Pnpt1 UTSW 11 29,095,475 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGCAATTACAGAAAGCCTGCAAG -3'
(R):5'- CAATAGGACTCAGGAAGTTCACCGC -3'

Sequencing Primer
(F):5'- AAGCCTGCAAGGATTGCTTTC -3'
(R):5'- AAGAGACTTAGGCTGCTTGATTCC -3'
Posted On 2014-04-13