Incidental Mutation 'R1524:Skic3'
ID 167738
Institutional Source Beutler Lab
Gene Symbol Skic3
Ensembl Gene ENSMUSG00000033991
Gene Name SKI3 subunit of superkiller complex
Synonyms Ttc37
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 76246853-76338435 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 76286491 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 891 (D891E)
Ref Sequence ENSEMBL: ENSMUSP00000153521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
AlphaFold F8VPK0
Predicted Effect probably benign
Transcript: ENSMUST00000091466
AA Change: D891E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: D891E

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224386
AA Change: D891E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225341
Meta Mutation Damage Score 0.1306 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Skic3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Skic3 APN 13 76,291,397 (GRCm39) critical splice donor site probably null
IGL00650:Skic3 APN 13 76,275,626 (GRCm39) missense possibly damaging 0.89
IGL00838:Skic3 APN 13 76,282,910 (GRCm39) missense probably damaging 0.99
IGL00958:Skic3 APN 13 76,270,864 (GRCm39) missense probably damaging 0.98
IGL01011:Skic3 APN 13 76,270,784 (GRCm39) missense probably damaging 0.97
IGL01062:Skic3 APN 13 76,303,581 (GRCm39) nonsense probably null
IGL01319:Skic3 APN 13 76,277,498 (GRCm39) missense probably benign 0.29
IGL01697:Skic3 APN 13 76,276,852 (GRCm39) missense probably benign 0.01
IGL02061:Skic3 APN 13 76,277,660 (GRCm39) critical splice donor site probably null
IGL02184:Skic3 APN 13 76,259,810 (GRCm39) missense probably damaging 1.00
IGL02309:Skic3 APN 13 76,275,166 (GRCm39) missense possibly damaging 0.90
IGL03230:Skic3 APN 13 76,303,766 (GRCm39) splice site probably benign
IGL03354:Skic3 APN 13 76,330,941 (GRCm39) missense possibly damaging 0.71
caviar UTSW 13 76,295,886 (GRCm39) missense possibly damaging 0.54
gourmet UTSW 13 76,298,638 (GRCm39) missense probably damaging 1.00
tartare UTSW 13 76,333,298 (GRCm39) missense probably damaging 0.96
R0501:Skic3 UTSW 13 76,295,925 (GRCm39) missense probably benign
R0628:Skic3 UTSW 13 76,298,848 (GRCm39) missense possibly damaging 0.89
R0711:Skic3 UTSW 13 76,331,010 (GRCm39) missense probably damaging 1.00
R0928:Skic3 UTSW 13 76,261,711 (GRCm39) missense probably damaging 1.00
R1402:Skic3 UTSW 13 76,279,533 (GRCm39) missense probably damaging 1.00
R1402:Skic3 UTSW 13 76,279,533 (GRCm39) missense probably damaging 1.00
R1628:Skic3 UTSW 13 76,259,910 (GRCm39) missense possibly damaging 0.75
R1702:Skic3 UTSW 13 76,270,862 (GRCm39) missense possibly damaging 0.66
R1750:Skic3 UTSW 13 76,288,720 (GRCm39) missense possibly damaging 0.89
R1822:Skic3 UTSW 13 76,278,407 (GRCm39) missense probably benign 0.35
R1885:Skic3 UTSW 13 76,278,354 (GRCm39) missense probably benign 0.11
R1885:Skic3 UTSW 13 76,261,166 (GRCm39) missense probably benign 0.00
R1923:Skic3 UTSW 13 76,282,889 (GRCm39) missense probably damaging 1.00
R1978:Skic3 UTSW 13 76,282,934 (GRCm39) missense probably benign 0.00
R2040:Skic3 UTSW 13 76,328,222 (GRCm39) missense probably damaging 1.00
R2136:Skic3 UTSW 13 76,321,473 (GRCm39) missense possibly damaging 0.87
R2268:Skic3 UTSW 13 76,260,393 (GRCm39) unclassified probably benign
R2483:Skic3 UTSW 13 76,330,986 (GRCm39) missense probably damaging 1.00
R2988:Skic3 UTSW 13 76,303,808 (GRCm39) missense probably benign 0.11
R3701:Skic3 UTSW 13 76,261,798 (GRCm39) missense probably benign
R3951:Skic3 UTSW 13 76,278,338 (GRCm39) missense probably damaging 1.00
R4405:Skic3 UTSW 13 76,303,784 (GRCm39) missense probably damaging 0.97
R4411:Skic3 UTSW 13 76,275,623 (GRCm39) missense possibly damaging 0.89
R4957:Skic3 UTSW 13 76,333,232 (GRCm39) splice site probably null
R4960:Skic3 UTSW 13 76,333,275 (GRCm39) missense possibly damaging 0.95
R4993:Skic3 UTSW 13 76,331,055 (GRCm39) missense probably damaging 0.96
R5206:Skic3 UTSW 13 76,295,886 (GRCm39) missense possibly damaging 0.54
R5208:Skic3 UTSW 13 76,295,886 (GRCm39) missense possibly damaging 0.54
R5302:Skic3 UTSW 13 76,295,886 (GRCm39) missense possibly damaging 0.54
R5305:Skic3 UTSW 13 76,295,886 (GRCm39) missense possibly damaging 0.54
R5306:Skic3 UTSW 13 76,295,886 (GRCm39) missense possibly damaging 0.54
R5579:Skic3 UTSW 13 76,333,319 (GRCm39) missense probably damaging 1.00
R5618:Skic3 UTSW 13 76,321,545 (GRCm39) missense probably benign
R5726:Skic3 UTSW 13 76,266,466 (GRCm39) missense probably damaging 1.00
R5813:Skic3 UTSW 13 76,303,852 (GRCm39) missense probably benign 0.05
R5899:Skic3 UTSW 13 76,259,938 (GRCm39) splice site probably null
R6146:Skic3 UTSW 13 76,333,359 (GRCm39) missense probably damaging 1.00
R6224:Skic3 UTSW 13 76,266,410 (GRCm39) missense probably benign 0.02
R6286:Skic3 UTSW 13 76,291,359 (GRCm39) missense probably damaging 1.00
R6402:Skic3 UTSW 13 76,283,389 (GRCm39) missense probably benign 0.05
R6561:Skic3 UTSW 13 76,298,638 (GRCm39) missense probably damaging 1.00
R6808:Skic3 UTSW 13 76,333,298 (GRCm39) missense probably damaging 0.96
R7054:Skic3 UTSW 13 76,283,079 (GRCm39) missense probably damaging 1.00
R7261:Skic3 UTSW 13 76,261,698 (GRCm39) missense probably benign 0.30
R7267:Skic3 UTSW 13 76,328,196 (GRCm39) missense probably benign 0.15
R7348:Skic3 UTSW 13 76,331,003 (GRCm39) missense possibly damaging 0.82
R7384:Skic3 UTSW 13 76,298,854 (GRCm39) missense possibly damaging 0.53
R7404:Skic3 UTSW 13 76,296,866 (GRCm39) nonsense probably null
R7421:Skic3 UTSW 13 76,296,944 (GRCm39) missense probably benign 0.12
R7546:Skic3 UTSW 13 76,282,954 (GRCm39) missense probably damaging 1.00
R7771:Skic3 UTSW 13 76,283,149 (GRCm39) missense probably benign 0.21
R7960:Skic3 UTSW 13 76,260,318 (GRCm39) missense probably benign 0.03
R8125:Skic3 UTSW 13 76,278,446 (GRCm39) critical splice donor site probably null
R8136:Skic3 UTSW 13 76,261,222 (GRCm39) missense probably benign 0.00
R8680:Skic3 UTSW 13 76,303,587 (GRCm39) missense probably benign 0.01
R8697:Skic3 UTSW 13 76,328,274 (GRCm39) missense probably damaging 1.00
R8867:Skic3 UTSW 13 76,279,428 (GRCm39) missense probably damaging 0.99
R8872:Skic3 UTSW 13 76,333,326 (GRCm39) missense probably damaging 1.00
R8876:Skic3 UTSW 13 76,323,403 (GRCm39) missense probably benign 0.12
R8912:Skic3 UTSW 13 76,305,361 (GRCm39) splice site probably benign
R9174:Skic3 UTSW 13 76,295,893 (GRCm39) missense probably benign 0.00
R9334:Skic3 UTSW 13 76,281,076 (GRCm39) missense possibly damaging 0.65
R9389:Skic3 UTSW 13 76,275,158 (GRCm39) missense probably benign 0.02
R9422:Skic3 UTSW 13 76,278,447 (GRCm39) splice site probably benign
R9443:Skic3 UTSW 13 76,266,288 (GRCm39) missense probably benign 0.01
R9545:Skic3 UTSW 13 76,259,832 (GRCm39) missense probably damaging 1.00
R9596:Skic3 UTSW 13 76,330,968 (GRCm39) missense possibly damaging 0.64
X0067:Skic3 UTSW 13 76,281,052 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTTCAGGAGCAGGTCATATCTTCAGC -3'
(R):5'- GGGATTCAAAGTTTAACAACTGCCAGC -3'

Sequencing Primer
(F):5'- TGTAGAGGAATCTCTAAGACTGTGC -3'
(R):5'- agagtatagcaatagccacacc -3'
Posted On 2014-04-13