Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Ttc37'

167738

Institutional Source

Beutler Lab

Gene Symbol

Ttc37

Ensembl Gene

ENSMUSG00000033991

Gene Name

tetratricopeptide repeat domain 37

Synonyms

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76098734-76190316 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 76138372 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 891 (D891E)

Ref Sequence

ENSEMBL: ENSMUSP00000153521 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]

AlphaFold

F8VPK0

Predicted Effect

probably benign
Transcript: ENSMUST00000091466
AA Change: D891E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: D891E

Domain	Start	End	E-Value	Type
TPR	6	39	2.92e1	SMART
TPR	40	73	1.1e-1	SMART
TPR	272	305	9.45e0	SMART
TPR	306	339	8.9e-2	SMART
SEL1	420	451	1.45e2	SMART
TPR	420	453	2.55e-2	SMART
SEL1	454	490	1.15e1	SMART
TPR	454	492	2.84e1	SMART
TPR	493	527	1.92e1	SMART
TPR	564	597	7.34e-3	SMART
TPR	598	631	1.81e-2	SMART
TPR	632	665	2.43e1	SMART
low complexity region	728	739	N/A	INTRINSIC
SEL1	861	892	3.58e1	SMART
TPR	861	894	2.14e-4	SMART
TPR	980	1013	1.56e1	SMART
Blast:TPR	1051	1084	7e-11	BLAST
Blast:TPR	1088	1121	7e-10	BLAST
TPR	1399	1432	4.31e0	SMART
low complexity region	1438	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224386
AA Change: D891E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224914

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225341

Meta Mutation Damage Score

0.1306

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Ttc37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Ttc37	APN	13	76143278	critical splice donor site	probably null
IGL00650:Ttc37	APN	13	76127507	missense	possibly damaging	0.89
IGL00838:Ttc37	APN	13	76134791	missense	probably damaging	0.99
IGL00958:Ttc37	APN	13	76122745	missense	probably damaging	0.98
IGL01011:Ttc37	APN	13	76122665	missense	probably damaging	0.97
IGL01062:Ttc37	APN	13	76155462	nonsense	probably null
IGL01319:Ttc37	APN	13	76129379	missense	probably benign	0.29
IGL01697:Ttc37	APN	13	76128733	missense	probably benign	0.01
IGL02061:Ttc37	APN	13	76129541	critical splice donor site	probably null
IGL02184:Ttc37	APN	13	76111691	missense	probably damaging	1.00
IGL02309:Ttc37	APN	13	76127047	missense	possibly damaging	0.90
IGL03230:Ttc37	APN	13	76155647	splice site	probably benign
IGL03354:Ttc37	APN	13	76182822	missense	possibly damaging	0.71
caviar	UTSW	13	76147767	missense	possibly damaging	0.54
gourmet	UTSW	13	76150519	missense	probably damaging	1.00
tartare	UTSW	13	76185179	missense	probably damaging	0.96
R0501:Ttc37	UTSW	13	76147806	missense	probably benign
R0628:Ttc37	UTSW	13	76150729	missense	possibly damaging	0.89
R0711:Ttc37	UTSW	13	76182891	missense	probably damaging	1.00
R0928:Ttc37	UTSW	13	76113592	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1402:Ttc37	UTSW	13	76131414	missense	probably damaging	1.00
R1628:Ttc37	UTSW	13	76111791	missense	possibly damaging	0.75
R1702:Ttc37	UTSW	13	76122743	missense	possibly damaging	0.66
R1750:Ttc37	UTSW	13	76140601	missense	possibly damaging	0.89
R1822:Ttc37	UTSW	13	76130288	missense	probably benign	0.35
R1885:Ttc37	UTSW	13	76113047	missense	probably benign	0.00
R1885:Ttc37	UTSW	13	76130235	missense	probably benign	0.11
R1923:Ttc37	UTSW	13	76134770	missense	probably damaging	1.00
R1978:Ttc37	UTSW	13	76134815	missense	probably benign	0.00
R2040:Ttc37	UTSW	13	76180103	missense	probably damaging	1.00
R2136:Ttc37	UTSW	13	76173354	missense	possibly damaging	0.87
R2268:Ttc37	UTSW	13	76112274	unclassified	probably benign
R2483:Ttc37	UTSW	13	76182867	missense	probably damaging	1.00
R2988:Ttc37	UTSW	13	76155689	missense	probably benign	0.11
R3701:Ttc37	UTSW	13	76113679	missense	probably benign
R3951:Ttc37	UTSW	13	76130219	missense	probably damaging	1.00
R4405:Ttc37	UTSW	13	76155665	missense	probably damaging	0.97
R4411:Ttc37	UTSW	13	76127504	missense	possibly damaging	0.89
R4957:Ttc37	UTSW	13	76185113	splice site	probably null
R4960:Ttc37	UTSW	13	76185156	missense	possibly damaging	0.95
R4993:Ttc37	UTSW	13	76182936	missense	probably damaging	0.96
R5206:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5208:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5302:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5305:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5306:Ttc37	UTSW	13	76147767	missense	possibly damaging	0.54
R5579:Ttc37	UTSW	13	76185200	missense	probably damaging	1.00
R5618:Ttc37	UTSW	13	76173426	missense	probably benign
R5726:Ttc37	UTSW	13	76118347	missense	probably damaging	1.00
R5813:Ttc37	UTSW	13	76155733	missense	probably benign	0.05
R5899:Ttc37	UTSW	13	76111819	splice site	probably null
R6146:Ttc37	UTSW	13	76185240	missense	probably damaging	1.00
R6224:Ttc37	UTSW	13	76118291	missense	probably benign	0.02
R6286:Ttc37	UTSW	13	76143240	missense	probably damaging	1.00
R6402:Ttc37	UTSW	13	76135270	missense	probably benign	0.05
R6561:Ttc37	UTSW	13	76150519	missense	probably damaging	1.00
R6808:Ttc37	UTSW	13	76185179	missense	probably damaging	0.96
R7054:Ttc37	UTSW	13	76134960	missense	probably damaging	1.00
R7261:Ttc37	UTSW	13	76113579	missense	probably benign	0.30
R7267:Ttc37	UTSW	13	76180077	missense	probably benign	0.15
R7348:Ttc37	UTSW	13	76182884	missense	possibly damaging	0.82
R7384:Ttc37	UTSW	13	76150735	missense	possibly damaging	0.53
R7404:Ttc37	UTSW	13	76148747	nonsense	probably null
R7421:Ttc37	UTSW	13	76148825	missense	probably benign	0.12
R7546:Ttc37	UTSW	13	76134835	missense	probably damaging	1.00
R7771:Ttc37	UTSW	13	76135030	missense	probably benign	0.21
R7960:Ttc37	UTSW	13	76112199	missense	probably benign	0.03
R8125:Ttc37	UTSW	13	76130327	critical splice donor site	probably null
R8136:Ttc37	UTSW	13	76113103	missense	probably benign	0.00
R8680:Ttc37	UTSW	13	76155468	missense	probably benign	0.01
R8697:Ttc37	UTSW	13	76180155	missense	probably damaging	1.00
R8867:Ttc37	UTSW	13	76131309	missense	probably damaging	0.99
R8872:Ttc37	UTSW	13	76185207	missense	probably damaging	1.00
R8876:Ttc37	UTSW	13	76175284	missense	probably benign	0.12
R8912:Ttc37	UTSW	13	76157242	splice site	probably benign
R9174:Ttc37	UTSW	13	76147774	missense	probably benign	0.00
R9334:Ttc37	UTSW	13	76132957	missense	possibly damaging	0.65
R9389:Ttc37	UTSW	13	76127039	missense	probably benign	0.02
R9422:Ttc37	UTSW	13	76130328	splice site	probably benign
R9443:Ttc37	UTSW	13	76118169	missense	probably benign	0.01
R9545:Ttc37	UTSW	13	76111713	missense	probably damaging	1.00
R9596:Ttc37	UTSW	13	76182849	missense	possibly damaging	0.64
X0067:Ttc37	UTSW	13	76132933	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- CTTCAGGAGCAGGTCATATCTTCAGC -3'
(R):5'- GGGATTCAAAGTTTAACAACTGCCAGC -3'

Sequencing Primer
(F):5'- TGTAGAGGAATCTCTAAGACTGTGC -3'
(R):5'- agagtatagcaatagccacacc -3'

Posted On

2014-04-13