Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Grin2a'

167745

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.448) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9663603 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 445 (S445P)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: S445P

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: S445P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: S445P

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: S445P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: S445P

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: S445P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Meta Mutation Damage Score

0.1818

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst1	A	T	18: 60,698,504	I594N	probably damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R6924:Grin2a	UTSW	16	9663228	missense	possibly damaging	0.71
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AGAACAGTGCCTTCATCCTCTACCC -3'
(R):5'- AGCTGAATGCTCAGCACTCATGC -3'

Sequencing Primer
(F):5'- CCCTGTTGGAATGAGAACCTG -3'
(R):5'- agagagagagagagagagagagag -3'

Posted On

2014-04-13