Incidental Mutation 'R1524:Wdr4'
ID 167748
Institutional Source Beutler Lab
Gene Symbol Wdr4
Ensembl Gene ENSMUSG00000024037
Gene Name WD repeat domain 4
Synonyms Wh, D530049K22Rik
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 31713296-31738946 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to C at 31728737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000167419] [ENSMUST00000171171] [ENSMUST00000171291]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000166626
SMART Domains Protein: ENSMUSP00000125954
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1kb0a2 18 93 1e-2 SMART
Blast:WD40 39 91 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167419
SMART Domains Protein: ENSMUSP00000127617
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1e1aa_ 71 143 5e-4 SMART
Blast:WD40 74 134 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169224
Predicted Effect probably benign
Transcript: ENSMUST00000170176
SMART Domains Protein: ENSMUSP00000127073
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
SCOP:d1e1aa_ 33 105 9e-4 SMART
Blast:WD40 36 96 8e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171171
SMART Domains Protein: ENSMUSP00000126061
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
WD40 74 134 1.58e2 SMART
WD40 137 175 2.37e2 SMART
WD40 178 218 4.44e0 SMART
WD40 222 262 3.5e-4 SMART
low complexity region 417 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171592
Predicted Effect probably benign
Transcript: ENSMUST00000172284
SMART Domains Protein: ENSMUSP00000129736
Gene: ENSMUSG00000024037

DomainStartEndE-ValueType
Blast:WD40 36 88 2e-30 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null allele display lethality during organogenesis with increased apoptosis and DNA damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Ptgr3 A G 18: 84,112,831 (GRCm39) E169G probably benign Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Wdr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Wdr4 APN 17 31,720,232 (GRCm39) missense possibly damaging 0.94
IGL03158:Wdr4 APN 17 31,718,102 (GRCm39) missense probably benign 0.00
R0091:Wdr4 UTSW 17 31,715,890 (GRCm39) missense probably benign 0.01
R2009:Wdr4 UTSW 17 31,719,584 (GRCm39) splice site probably benign
R3822:Wdr4 UTSW 17 31,731,195 (GRCm39) missense probably damaging 0.99
R4334:Wdr4 UTSW 17 31,718,126 (GRCm39) missense possibly damaging 0.70
R4786:Wdr4 UTSW 17 31,728,785 (GRCm39) missense probably damaging 1.00
R4873:Wdr4 UTSW 17 31,718,129 (GRCm39) missense probably benign 0.05
R4875:Wdr4 UTSW 17 31,718,129 (GRCm39) missense probably benign 0.05
R5117:Wdr4 UTSW 17 31,718,798 (GRCm39) missense probably benign 0.00
R5372:Wdr4 UTSW 17 31,729,554 (GRCm39) missense probably damaging 1.00
R5757:Wdr4 UTSW 17 31,718,063 (GRCm39) missense probably damaging 0.98
R6024:Wdr4 UTSW 17 31,720,272 (GRCm39) intron probably benign
R7401:Wdr4 UTSW 17 31,728,806 (GRCm39) missense probably damaging 1.00
R7836:Wdr4 UTSW 17 31,718,782 (GRCm39) critical splice donor site probably null
R9727:Wdr4 UTSW 17 31,718,045 (GRCm39) missense probably benign 0.14
Z1176:Wdr4 UTSW 17 31,728,873 (GRCm39) missense probably benign 0.15
Z1187:Wdr4 UTSW 17 31,731,177 (GRCm39) missense probably damaging 1.00
Z1192:Wdr4 UTSW 17 31,731,177 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACAGGCTGTCCTAGCTAAAC -3'
(R):5'- GGCTGCATGAACTGACTGACCAAC -3'

Sequencing Primer
(F):5'- AAACTGGCTGCTTAACCCTC -3'
(R):5'- TCACCTGTGTTAGGATGGACAAG -3'
Posted On 2014-04-13