Mutagenetix > Incidental Mutation

Incidental Mutation 'R1524:Ndst1'

167751

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

039565-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1524 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 60698504 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 594 (I594N)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

AlphaFold

Q3UHN9

Predicted Effect

probably damaging
Transcript: ENSMUST00000169273
AA Change: I594N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: I594N

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Meta Mutation Damage Score

0.3683

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (68/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	G	T	5: 87,971,689	V102L	probably benign	Het
Adck1	T	C	12: 88,402,084	Y111H	probably damaging	Het
Adcy10	G	T	1: 165,518,403	K340N	probably damaging	Het
Aebp1	T	C	11: 5,870,089	V355A	probably damaging	Het
Atp2b2	T	C	6: 113,774,201		probably benign	Het
Atrn	T	C	2: 130,957,080	V390A	probably benign	Het
Bpifc	T	A	10: 85,977,735	Q315L	probably benign	Het
C1qtnf6	T	G	15: 78,524,892		probably null	Het
Cab39l	A	G	14: 59,519,737		probably benign	Het
Capn12	T	A	7: 28,882,764		probably benign	Het
Ceacam18	A	C	7: 43,639,355	T177P	possibly damaging	Het
Ces5a	A	T	8: 93,525,665	F200I	probably damaging	Het
Cldn19	G	T	4: 119,257,051		probably null	Het
Cntnap2	A	G	6: 46,530,679	S46P	probably damaging	Het
Dchs1	A	G	7: 105,764,525	Y1028H	probably damaging	Het
Exd1	A	T	2: 119,524,674	F253L	probably damaging	Het
Fam161a	A	G	11: 23,015,826	N40D	possibly damaging	Het
Fam81a	A	T	9: 70,125,108	I34N	probably damaging	Het
Fchsd1	A	C	18: 37,965,897		probably null	Het
Fut11	T	A	14: 20,696,166	F359I	possibly damaging	Het
Fut7	T	C	2: 25,425,147	V92A	probably damaging	Het
Grid2	C	G	6: 64,429,754	F699L	possibly damaging	Het
Grin2a	A	G	16: 9,663,603	S445P	possibly damaging	Het
H2al2b	A	C	Y: 2,720,391	F95C	probably damaging	Het
Hecw2	T	C	1: 53,851,618	D1246G	probably damaging	Het
Ifit1	A	G	19: 34,647,632	N56S	probably damaging	Het
Ldb3	C	A	14: 34,555,356	V354L	probably benign	Het
Lrig2	T	C	3: 104,463,876	Y479C	probably benign	Het
Ltn1	A	G	16: 87,381,556	V1595A	probably damaging	Het
Macf1	A	G	4: 123,432,530	V2939A	possibly damaging	Het
Mapre3	T	G	5: 30,861,917	I35S	probably damaging	Het
Med16	A	T	10: 79,898,316	L588Q	probably damaging	Het
Ncapg2	T	C	12: 116,434,578		probably benign	Het
Ncstn	C	A	1: 172,072,149	R322L	possibly damaging	Het
Ndst3	A	G	3: 123,548,906	I752T	possibly damaging	Het
Obscn	G	T	11: 59,115,855	S1185R	probably damaging	Het
Olfr1466	T	A	19: 13,342,122	C121*	probably null	Het
Olfr1500	A	T	19: 13,828,315	L27H	probably damaging	Het
Olfr303	A	G	7: 86,394,812	S229P	probably benign	Het
Otof	T	A	5: 30,379,556	D1285V	probably benign	Het
Pcnx2	A	G	8: 125,891,141	I125T	probably benign	Het
Pde4a	T	C	9: 21,201,247	S240P	probably damaging	Het
Pi15	T	C	1: 17,619,852	S126P	probably benign	Het
Pkhd1	T	C	1: 20,117,780	S3435G	probably damaging	Het
Plin1	C	A	7: 79,726,590	V133L	probably benign	Het
Pnpt1	T	A	11: 29,130,776	C7S	unknown	Het
Ppp3ca	A	T	3: 136,797,818	M51L	probably benign	Het
Primpol	G	T	8: 46,586,467		probably benign	Het
Prlr	T	C	15: 10,319,333	V116A	probably damaging	Het
Rnf139	A	G	15: 58,889,417	D35G	probably damaging	Het
Rsbn1l	T	A	5: 20,951,673	K38M	probably damaging	Het
Ryr3	T	A	2: 112,869,082	I888F	probably damaging	Het
Sec16a	C	A	2: 26,428,382	V1566F	probably damaging	Het
Sin3b	A	G	8: 72,753,287	T874A	probably benign	Het
Slc5a5	A	C	8: 70,892,334	Y110D	probably damaging	Het
Smarcd2	C	T	11: 106,267,152	V97I	probably benign	Het
St6galnac2	G	A	11: 116,684,487		probably benign	Het
Tbc1d22b	T	C	17: 29,570,611	L149P	probably damaging	Het
Tekt2	T	C	4: 126,323,649	I208V	probably benign	Het
Tenm3	A	G	8: 48,228,981	I2522T	possibly damaging	Het
Ttc37	T	A	13: 76,138,372	D891E	probably benign	Het
Ttll5	T	A	12: 85,864,568	Y233*	probably null	Het
Vcpip1	C	T	1: 9,724,502	E1215K	probably damaging	Het
Wdr4	T	C	17: 31,509,763		probably benign	Het
Zadh2	A	G	18: 84,094,706	E169G	probably benign	Het
Zfp703	G	A	8: 26,979,373	G355D	probably damaging	Het
Zfp830	T	A	11: 82,764,968	D199E	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R5968:Ndst1	UTSW	18	60713076	missense	probably benign
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
R8918:Ndst1	UTSW	18	60692011	missense	probably benign	0.00
R8951:Ndst1	UTSW	18	60697124	missense	probably benign
R9187:Ndst1	UTSW	18	60691196	missense	probably benign	0.03
R9374:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9526:Ndst1	UTSW	18	60705148	nonsense	probably null
R9552:Ndst1	UTSW	18	60712859	missense	probably damaging	0.97
R9651:Ndst1	UTSW	18	60700467	missense	probably damaging	0.96
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAGGCAATTCATACTCGTCCCC -3'
(R):5'- GTGTCAGTGCATCAGAGACCAGAAG -3'

Sequencing Primer
(F):5'- AATTCATACTCGTCCCCACATTG -3'
(R):5'- acgcctctaataccagcac -3'

Posted On

2014-04-13