Incidental Mutation 'R1524:Ptgr3'
ID 167752
Institutional Source Beutler Lab
Gene Symbol Ptgr3
Ensembl Gene ENSMUSG00000049090
Gene Name prostaglandin reductase 3
Synonyms C530046K17Rik, Pthr3, Zadh2
MMRRC Submission 039565-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.189) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 84106250-84115579 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84112831 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 169 (E169G)
Ref Sequence ENSEMBL: ENSMUSP00000052544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060223]
AlphaFold Q8BGC4
Predicted Effect probably benign
Transcript: ENSMUST00000060223
AA Change: E169G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052544
Gene: ENSMUSG00000049090
AA Change: E169G

DomainStartEndE-ValueType
Pfam:ADH_N_2 42 183 1.5e-14 PFAM
Pfam:ADH_N 62 126 4e-8 PFAM
Pfam:ADH_zinc_N 184 321 9e-30 PFAM
Pfam:ADH_zinc_N_2 216 367 1.7e-16 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,119,548 (GRCm39) V102L probably benign Het
Adck1 T C 12: 88,368,854 (GRCm39) Y111H probably damaging Het
Adcy10 G T 1: 165,345,972 (GRCm39) K340N probably damaging Het
Aebp1 T C 11: 5,820,089 (GRCm39) V355A probably damaging Het
Atp2b2 T C 6: 113,751,162 (GRCm39) probably benign Het
Atrn T C 2: 130,799,000 (GRCm39) V390A probably benign Het
Bpifc T A 10: 85,813,599 (GRCm39) Q315L probably benign Het
C1qtnf6 T G 15: 78,409,092 (GRCm39) probably null Het
Cab39l A G 14: 59,757,186 (GRCm39) probably benign Het
Capn12 T A 7: 28,582,189 (GRCm39) probably benign Het
Ceacam18 A C 7: 43,288,779 (GRCm39) T177P possibly damaging Het
Ces5a A T 8: 94,252,293 (GRCm39) F200I probably damaging Het
Cldn19 G T 4: 119,114,248 (GRCm39) probably null Het
Cntnap2 A G 6: 46,507,613 (GRCm39) S46P probably damaging Het
Dchs1 A G 7: 105,413,732 (GRCm39) Y1028H probably damaging Het
Exd1 A T 2: 119,355,155 (GRCm39) F253L probably damaging Het
Fam161a A G 11: 22,965,826 (GRCm39) N40D possibly damaging Het
Fam81a A T 9: 70,032,390 (GRCm39) I34N probably damaging Het
Fchsd1 A C 18: 38,098,950 (GRCm39) probably null Het
Fut11 T A 14: 20,746,234 (GRCm39) F359I possibly damaging Het
Fut7 T C 2: 25,315,159 (GRCm39) V92A probably damaging Het
Grid2 C G 6: 64,406,738 (GRCm39) F699L possibly damaging Het
Grin2a A G 16: 9,481,467 (GRCm39) S445P possibly damaging Het
H2al2b A C Y: 2,720,391 (GRCm39) F95C probably damaging Het
Hecw2 T C 1: 53,890,777 (GRCm39) D1246G probably damaging Het
Ifit1 A G 19: 34,625,032 (GRCm39) N56S probably damaging Het
Ldb3 C A 14: 34,277,313 (GRCm39) V354L probably benign Het
Lrig2 T C 3: 104,371,192 (GRCm39) Y479C probably benign Het
Ltn1 A G 16: 87,178,444 (GRCm39) V1595A probably damaging Het
Macf1 A G 4: 123,326,323 (GRCm39) V2939A possibly damaging Het
Mapre3 T G 5: 31,019,261 (GRCm39) I35S probably damaging Het
Med16 A T 10: 79,734,150 (GRCm39) L588Q probably damaging Het
Ncapg2 T C 12: 116,398,198 (GRCm39) probably benign Het
Ncstn C A 1: 171,899,716 (GRCm39) R322L possibly damaging Het
Ndst1 A T 18: 60,831,576 (GRCm39) I594N probably damaging Het
Ndst3 A G 3: 123,342,555 (GRCm39) I752T possibly damaging Het
Obscn G T 11: 59,006,681 (GRCm39) S1185R probably damaging Het
Or5b112 T A 19: 13,319,486 (GRCm39) C121* probably null Het
Or6aa1 A G 7: 86,044,020 (GRCm39) S229P probably benign Het
Or9q1 A T 19: 13,805,679 (GRCm39) L27H probably damaging Het
Otof T A 5: 30,536,900 (GRCm39) D1285V probably benign Het
Pcnx2 A G 8: 126,617,880 (GRCm39) I125T probably benign Het
Pde4a T C 9: 21,112,543 (GRCm39) S240P probably damaging Het
Pi15 T C 1: 17,690,076 (GRCm39) S126P probably benign Het
Pkhd1 T C 1: 20,188,004 (GRCm39) S3435G probably damaging Het
Plin1 C A 7: 79,376,338 (GRCm39) V133L probably benign Het
Pnpt1 T A 11: 29,080,776 (GRCm39) C7S unknown Het
Ppp3ca A T 3: 136,503,579 (GRCm39) M51L probably benign Het
Primpol G T 8: 47,039,502 (GRCm39) probably benign Het
Prlr T C 15: 10,319,419 (GRCm39) V116A probably damaging Het
Rnf139 A G 15: 58,761,266 (GRCm39) D35G probably damaging Het
Rsbn1l T A 5: 21,156,671 (GRCm39) K38M probably damaging Het
Ryr3 T A 2: 112,699,427 (GRCm39) I888F probably damaging Het
Sec16a C A 2: 26,318,394 (GRCm39) V1566F probably damaging Het
Sin3b A G 8: 73,479,915 (GRCm39) T874A probably benign Het
Skic3 T A 13: 76,286,491 (GRCm39) D891E probably benign Het
Slc5a5 A C 8: 71,344,978 (GRCm39) Y110D probably damaging Het
Smarcd2 C T 11: 106,157,978 (GRCm39) V97I probably benign Het
St6galnac2 G A 11: 116,575,313 (GRCm39) probably benign Het
Tbc1d22b T C 17: 29,789,585 (GRCm39) L149P probably damaging Het
Tekt2 T C 4: 126,217,442 (GRCm39) I208V probably benign Het
Tenm3 A G 8: 48,682,016 (GRCm39) I2522T possibly damaging Het
Ttll5 T A 12: 85,911,342 (GRCm39) Y233* probably null Het
Vcpip1 C T 1: 9,794,727 (GRCm39) E1215K probably damaging Het
Wdr4 T C 17: 31,728,737 (GRCm39) probably benign Het
Zfp703 G A 8: 27,469,401 (GRCm39) G355D probably damaging Het
Zfp830 T A 11: 82,655,794 (GRCm39) D199E probably damaging Het
Other mutations in Ptgr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Ptgr3 APN 18 84,113,390 (GRCm39) nonsense probably null
IGL02653:Ptgr3 APN 18 84,113,443 (GRCm39) missense possibly damaging 0.82
R0678:Ptgr3 UTSW 18 84,113,287 (GRCm39) missense probably benign
R0905:Ptgr3 UTSW 18 84,113,332 (GRCm39) missense probably benign 0.00
R1434:Ptgr3 UTSW 18 84,112,596 (GRCm39) missense probably benign 0.42
R1862:Ptgr3 UTSW 18 84,113,443 (GRCm39) missense possibly damaging 0.82
R2141:Ptgr3 UTSW 18 84,112,668 (GRCm39) missense probably benign 0.00
R4299:Ptgr3 UTSW 18 84,112,626 (GRCm39) missense possibly damaging 0.94
R5378:Ptgr3 UTSW 18 84,112,803 (GRCm39) missense probably damaging 1.00
R7322:Ptgr3 UTSW 18 84,113,260 (GRCm39) missense probably damaging 1.00
R7394:Ptgr3 UTSW 18 84,106,315 (GRCm39) missense probably benign 0.00
R8141:Ptgr3 UTSW 18 84,112,651 (GRCm39) missense probably benign 0.01
R9731:Ptgr3 UTSW 18 84,113,128 (GRCm39) missense probably damaging 1.00
Z1088:Ptgr3 UTSW 18 84,113,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAAGCCACCCTTTGACATAG -3'
(R):5'- TGTAGTTGATGGGCCGATCACACC -3'

Sequencing Primer
(F):5'- GCCACCCTTTGACATAGGTTTTG -3'
(R):5'- CCAATTGATTTCAGAAAAGCTGCC -3'
Posted On 2014-04-13