Incidental Mutation 'R1524:Olfr1466'
ID 167753
Institutional Source Beutler Lab
Gene Symbol Olfr1466
Ensembl Gene ENSMUSG00000096485
Gene Name olfactory receptor 1466
Synonyms MOR202-12, GA_x6K02T2RE5P-3672907-3673839
MMRRC Submission 039565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1524 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13338862-13343572 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 13342122 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 121 (C121*)
Ref Sequence ENSEMBL: ENSMUSP00000147188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075868] [ENSMUST00000207124]
AlphaFold Q8VFW4
Predicted Effect probably null
Transcript: ENSMUST00000075868
AA Change: C121*
SMART Domains Protein: ENSMUSP00000075265
Gene: ENSMUSG00000096485
AA Change: C121*

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 4.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.9e-6 PFAM
Pfam:7tm_1 42 291 7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000207124
AA Change: C121*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,971,689 V102L probably benign Het
Adck1 T C 12: 88,402,084 Y111H probably damaging Het
Adcy10 G T 1: 165,518,403 K340N probably damaging Het
Aebp1 T C 11: 5,870,089 V355A probably damaging Het
Atp2b2 T C 6: 113,774,201 probably benign Het
Atrn T C 2: 130,957,080 V390A probably benign Het
Bpifc T A 10: 85,977,735 Q315L probably benign Het
C1qtnf6 T G 15: 78,524,892 probably null Het
Cab39l A G 14: 59,519,737 probably benign Het
Capn12 T A 7: 28,882,764 probably benign Het
Ceacam18 A C 7: 43,639,355 T177P possibly damaging Het
Ces5a A T 8: 93,525,665 F200I probably damaging Het
Cldn19 G T 4: 119,257,051 probably null Het
Cntnap2 A G 6: 46,530,679 S46P probably damaging Het
Dchs1 A G 7: 105,764,525 Y1028H probably damaging Het
Exd1 A T 2: 119,524,674 F253L probably damaging Het
Fam161a A G 11: 23,015,826 N40D possibly damaging Het
Fam81a A T 9: 70,125,108 I34N probably damaging Het
Fchsd1 A C 18: 37,965,897 probably null Het
Fut11 T A 14: 20,696,166 F359I possibly damaging Het
Fut7 T C 2: 25,425,147 V92A probably damaging Het
Grid2 C G 6: 64,429,754 F699L possibly damaging Het
Grin2a A G 16: 9,663,603 S445P possibly damaging Het
H2al2b A C Y: 2,720,391 F95C probably damaging Het
Hecw2 T C 1: 53,851,618 D1246G probably damaging Het
Ifit1 A G 19: 34,647,632 N56S probably damaging Het
Ldb3 C A 14: 34,555,356 V354L probably benign Het
Lrig2 T C 3: 104,463,876 Y479C probably benign Het
Ltn1 A G 16: 87,381,556 V1595A probably damaging Het
Macf1 A G 4: 123,432,530 V2939A possibly damaging Het
Mapre3 T G 5: 30,861,917 I35S probably damaging Het
Med16 A T 10: 79,898,316 L588Q probably damaging Het
Ncapg2 T C 12: 116,434,578 probably benign Het
Ncstn C A 1: 172,072,149 R322L possibly damaging Het
Ndst1 A T 18: 60,698,504 I594N probably damaging Het
Ndst3 A G 3: 123,548,906 I752T possibly damaging Het
Obscn G T 11: 59,115,855 S1185R probably damaging Het
Olfr1500 A T 19: 13,828,315 L27H probably damaging Het
Olfr303 A G 7: 86,394,812 S229P probably benign Het
Otof T A 5: 30,379,556 D1285V probably benign Het
Pcnx2 A G 8: 125,891,141 I125T probably benign Het
Pde4a T C 9: 21,201,247 S240P probably damaging Het
Pi15 T C 1: 17,619,852 S126P probably benign Het
Pkhd1 T C 1: 20,117,780 S3435G probably damaging Het
Plin1 C A 7: 79,726,590 V133L probably benign Het
Pnpt1 T A 11: 29,130,776 C7S unknown Het
Ppp3ca A T 3: 136,797,818 M51L probably benign Het
Primpol G T 8: 46,586,467 probably benign Het
Prlr T C 15: 10,319,333 V116A probably damaging Het
Rnf139 A G 15: 58,889,417 D35G probably damaging Het
Rsbn1l T A 5: 20,951,673 K38M probably damaging Het
Ryr3 T A 2: 112,869,082 I888F probably damaging Het
Sec16a C A 2: 26,428,382 V1566F probably damaging Het
Sin3b A G 8: 72,753,287 T874A probably benign Het
Slc5a5 A C 8: 70,892,334 Y110D probably damaging Het
Smarcd2 C T 11: 106,267,152 V97I probably benign Het
St6galnac2 G A 11: 116,684,487 probably benign Het
Tbc1d22b T C 17: 29,570,611 L149P probably damaging Het
Tekt2 T C 4: 126,323,649 I208V probably benign Het
Tenm3 A G 8: 48,228,981 I2522T possibly damaging Het
Ttc37 T A 13: 76,138,372 D891E probably benign Het
Ttll5 T A 12: 85,864,568 Y233* probably null Het
Vcpip1 C T 1: 9,724,502 E1215K probably damaging Het
Wdr4 T C 17: 31,509,763 probably benign Het
Zadh2 A G 18: 84,094,706 E169G probably benign Het
Zfp703 G A 8: 26,979,373 G355D probably damaging Het
Zfp830 T A 11: 82,764,968 D199E probably damaging Het
Other mutations in Olfr1466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Olfr1466 APN 19 13342120 missense probably benign 0.13
IGL02568:Olfr1466 APN 19 13342219 missense probably benign 0.08
IGL03073:Olfr1466 APN 19 13342022 missense probably benign 0.00
R0943:Olfr1466 UTSW 19 13341793 missense probably benign 0.00
R1301:Olfr1466 UTSW 19 13341847 missense probably benign 0.05
R1355:Olfr1466 UTSW 19 13342518 nonsense probably null
R1568:Olfr1466 UTSW 19 13342175 missense probably benign 0.14
R1993:Olfr1466 UTSW 19 13341814 missense possibly damaging 0.65
R2031:Olfr1466 UTSW 19 13342406 missense probably benign 0.18
R3693:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3694:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3853:Olfr1466 UTSW 19 13342498 missense possibly damaging 0.55
R5313:Olfr1466 UTSW 19 13342065 missense probably benign 0.07
R5467:Olfr1466 UTSW 19 13342157 missense probably damaging 1.00
R6060:Olfr1466 UTSW 19 13342133 missense probably benign 0.08
R7125:Olfr1466 UTSW 19 13341739 critical splice acceptor site probably null
R7591:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
R9072:Olfr1466 UTSW 19 13341874 missense possibly damaging 0.80
R9073:Olfr1466 UTSW 19 13341874 missense possibly damaging 0.80
Z1177:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGACACACTTTCTCCTGCTGGGAC -3'
(R):5'- CTGAACTCCTGCTTCTGAGTGCATC -3'

Sequencing Primer
(F):5'- TGGGACTCACTGATGATCCAG -3'
(R):5'- CTGGCTTGATAAATAAGTACCAGTTC -3'
Posted On 2014-04-13