Incidental Mutation 'R1525:Olfr1188'
ID167762
Institutional Source Beutler Lab
Gene Symbol Olfr1188
Ensembl Gene ENSMUSG00000068809
Gene Nameolfactory receptor 1188
SynonymsMOR238-2, GA_x6K02T2Q125-50046879-50047784
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1525 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88556935-88560815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 88559641 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 57 (S57R)
Ref Sequence ENSEMBL: ENSMUSP00000088202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090701] [ENSMUST00000217131]
Predicted Effect probably damaging
Transcript: ENSMUST00000090701
AA Change: S57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088202
Gene: ENSMUSG00000068809
AA Change: S57R

DomainStartEndE-ValueType
Pfam:7tm_4 36 309 5.9e-49 PFAM
Pfam:7tm_1 46 292 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217131
AA Change: S46R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Cyp2d11 G T 15: 82,389,297 L458I probably damaging Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Ints9 T C 14: 64,995,011 I173T probably benign Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mep1a T C 17: 43,491,636 Q166R probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Olfr720 T A 14: 14,175,725 Y119F probably damaging Het
Pdilt T A 7: 119,487,994 T478S probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Ranbp3 A G 17: 56,710,865 D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Olfr1188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Olfr1188 APN 2 88560065 missense probably benign 0.02
R1530:Olfr1188 UTSW 2 88559483 missense probably benign 0.23
R1703:Olfr1188 UTSW 2 88560255 missense possibly damaging 0.56
R1750:Olfr1188 UTSW 2 88560058 missense possibly damaging 0.94
R4626:Olfr1188 UTSW 2 88559832 missense possibly damaging 0.69
R4645:Olfr1188 UTSW 2 88560378 missense probably damaging 0.98
R4934:Olfr1188 UTSW 2 88559586 missense probably benign 0.00
R5643:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R5644:Olfr1188 UTSW 2 88559505 start codon destroyed probably null 0.90
R6539:Olfr1188 UTSW 2 88559520 missense probably damaging 1.00
R7079:Olfr1188 UTSW 2 88559509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAACAGCATTCAACTGAGAG -3'
(R):5'- TCATCCTGGAGGCATAGTGCAGAG -3'

Sequencing Primer
(F):5'- CAACAGCATTCAACTGAGAGAAAAG -3'
(R):5'- TAGCGGTCATAGGCCATAAC -3'
Posted On2014-04-13