Incidental Mutation 'R1525:Pdilt'
ID167786
Institutional Source Beutler Lab
Gene Symbol Pdilt
Ensembl Gene ENSMUSG00000030968
Gene Nameprotein disulfide isomerase-like, testis expressed
SynonymsPDILT, 1700007B13Rik
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R1525 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location119486587-119523489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119487994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 478 (T478S)
Ref Sequence ENSEMBL: ENSMUSP00000033267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033267] [ENSMUST00000208275]
Predicted Effect probably damaging
Transcript: ENSMUST00000033267
AA Change: T478S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033267
Gene: ENSMUSG00000030968
AA Change: T478S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
Pfam:Thioredoxin_6 177 362 6e-35 PFAM
Pfam:Thioredoxin 385 489 3.7e-16 PFAM
low complexity region 495 512 N/A INTRINSIC
low complexity region 551 579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208275
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has has an N-terminal ER-signal sequence, two thioredoxin (TRX) domains with non-classical Ser-Lys-Gln-Ser and Ser-Lys-Lys-Cys motifs, respectively, two TRX-like domains, and a C-terminal ER-retention sequence. The protein lacks oxidoreductase activity in vitro and probably functions as a chaperone. This gene's expression appears to be limited to the testis. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility and abnormal sperm physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Cyp2d11 G T 15: 82,389,297 L458I probably damaging Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Ints9 T C 14: 64,995,011 I173T probably benign Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mep1a T C 17: 43,491,636 Q166R probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr1188 C G 2: 88,559,641 S57R probably damaging Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Olfr720 T A 14: 14,175,725 Y119F probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Ranbp3 A G 17: 56,710,865 D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Pdilt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Pdilt APN 7 119500444 missense probably damaging 1.00
IGL02102:Pdilt APN 7 119486950 missense probably benign 0.28
IGL02312:Pdilt APN 7 119519667 missense probably benign 0.03
IGL02887:Pdilt APN 7 119498049 missense possibly damaging 0.86
R0670:Pdilt UTSW 7 119500428 missense probably benign 0.03
R0759:Pdilt UTSW 7 119489484 nonsense probably null
R1612:Pdilt UTSW 7 119486975 missense possibly damaging 0.95
R1633:Pdilt UTSW 7 119487994 missense probably damaging 1.00
R1848:Pdilt UTSW 7 119489384 missense probably benign 0.02
R3026:Pdilt UTSW 7 119514954 missense probably benign 0.01
R3546:Pdilt UTSW 7 119500488 nonsense probably null
R4406:Pdilt UTSW 7 119495009 missense probably damaging 1.00
R5331:Pdilt UTSW 7 119514924 missense possibly damaging 0.67
R5459:Pdilt UTSW 7 119486935 missense probably benign 0.01
R5771:Pdilt UTSW 7 119494994 missense probably damaging 0.98
R5807:Pdilt UTSW 7 119500543 unclassified probably benign
R6143:Pdilt UTSW 7 119495042 missense probably damaging 1.00
R6456:Pdilt UTSW 7 119500483 missense probably damaging 0.99
R6850:Pdilt UTSW 7 119486959 missense probably damaging 0.98
R7159:Pdilt UTSW 7 119487951 missense probably benign 0.01
R7676:Pdilt UTSW 7 119494997 missense probably damaging 1.00
R8266:Pdilt UTSW 7 119489381 missense probably benign 0.01
R8282:Pdilt UTSW 7 119498070 missense probably damaging 1.00
R8437:Pdilt UTSW 7 119514886 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACCATCTCAGGAATGTGACAAGCG -3'
(R):5'- GCCATGAGGGTATGTAATCCAGCC -3'

Sequencing Primer
(F):5'- AGCTCACTCAAAGTAGATGGC -3'
(R):5'- tcatgtcccctgatgagagag -3'
Posted On2014-04-13