Mutagenetix > Incidental Mutation

Incidental Mutation 'R1525:Ice1'

167804

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

040872-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R1525 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70605410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 852 (H852Q)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

probably benign
Transcript: ENSMUST00000043493
AA Change: H852Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: H852Q

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
4931440F15Rik	A	C	11: 29,823,994	Y488D	probably benign	Het
Abcc3	A	T	11: 94,361,236	H840Q	probably benign	Het
Amotl2	C	T	9: 102,728,568	R540C	probably damaging	Het
Brpf1	A	G	6: 113,317,154	E605G	probably damaging	Het
Cacna2d3	T	C	14: 28,972,242	I865V	probably benign	Het
Cdh24	A	T	14: 54,638,589	F199I	probably damaging	Het
Cdk9	A	G	2: 32,710,509	V27A	probably damaging	Het
Cfap69	G	T	5: 5,640,230		probably null	Het
Cyp2d11	G	T	15: 82,389,297	L458I	probably damaging	Het
Dchs1	T	C	7: 105,758,931	E1898G	probably damaging	Het
Dennd4b	G	T	3: 90,270,870	L456F	probably damaging	Het
Dgat1	T	C	15: 76,511,586	T66A	probably benign	Het
Dock10	C	A	1: 80,606,164		probably null	Het
Fam110b	A	G	4: 5,799,578	D332G	possibly damaging	Het
Frmd4b	G	A	6: 97,296,386	P628S	probably damaging	Het
Il17ra	T	C	6: 120,473,790	V116A	probably damaging	Het
Ints9	T	C	14: 64,995,011	I173T	probably benign	Het
Kctd14	A	T	7: 97,457,867	M110L	probably benign	Het
Krt6a	T	G	15: 101,694,202	Y16S	probably benign	Het
Lamc2	T	C	1: 153,130,756	N883S	probably benign	Het
Larp4b	C	T	13: 9,145,450	T195M	probably damaging	Het
Lrp1	A	G	10: 127,539,529	L4432P	probably damaging	Het
Mei4	T	C	9: 81,890,199	S22P	probably damaging	Het
Mep1a	T	C	17: 43,491,636	Q166R	probably damaging	Het
Mroh2b	C	A	15: 4,951,130		probably null	Het
Myoc	T	G	1: 162,648,651	L308R	probably damaging	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Olfr1188	C	G	2: 88,559,641	S57R	probably damaging	Het
Olfr50	A	T	2: 36,794,143	R302S	probably null	Het
Olfr720	T	A	14: 14,175,725	Y119F	probably damaging	Het
Pdilt	T	A	7: 119,487,994	T478S	probably damaging	Het
Pias1	T	C	9: 62,920,487	K222E	probably damaging	Het
Prss16	A	C	13: 22,009,443	L61V	possibly damaging	Het
Pvr	G	A	7: 19,910,626	Q328*	probably null	Het
Ranbp3	A	G	17: 56,710,865	D481G	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,908		probably benign	Het
Ryr3	G	T	2: 112,678,090	D3419E	probably damaging	Het
Scn1a	C	T	2: 66,319,462	W946*	probably null	Het
Sh3pxd2a	T	C	19: 47,278,425	K242E	probably damaging	Het
Slc34a2	A	G	5: 53,069,506	D657G	probably benign	Het
Stard9	T	A	2: 120,702,052	I2930K	probably benign	Het
Syna	T	C	5: 134,559,258	D279G	probably benign	Het
Tfr2	T	C	5: 137,579,030	F415L	probably benign	Het
Tmem97	T	A	11: 78,542,760	Y103F	probably damaging	Het
Tmem97	A	T	11: 78,542,761	Y103N	probably damaging	Het
Txndc2	T	A	17: 65,638,315	D289V	probably damaging	Het
Zbtb1	T	G	12: 76,386,432	D397E	probably benign	Het
Zc3h18	T	C	8: 122,413,938	S847P	probably benign	Het
Zfp382	G	A	7: 30,133,719	G265E	probably damaging	Het
Zfp410	T	C	12: 84,322,966	L39S	probably damaging	Het
Zfp729a	G	T	13: 67,619,321	P930T	probably benign	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
R9452:Ice1	UTSW	13	70596343	missense	probably damaging	1.00
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGGGTTTCGCCAAGACACAG -3'
(R):5'- ATGGCACCGCAGTGATGTCCTAAG -3'

Sequencing Primer
(F):5'- GTTTCGCCAAGACACAGATACTTC -3'
(R):5'- AGAGCTTCCTCAGAGTACCAG -3'

Posted On

2014-04-13