Incidental Mutation 'R1525:Ice1'
ID 167804
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 040872-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R1525 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70753529 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 852 (H852Q)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably benign
Transcript: ENSMUST00000043493
AA Change: H852Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: H852Q

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A T 11: 94,252,062 (GRCm39) H840Q probably benign Het
Amotl2 C T 9: 102,605,767 (GRCm39) R540C probably damaging Het
Brpf1 A G 6: 113,294,115 (GRCm39) E605G probably damaging Het
Cacna2d3 T C 14: 28,694,199 (GRCm39) I865V probably benign Het
Cdh24 A T 14: 54,876,046 (GRCm39) F199I probably damaging Het
Cdk9 A G 2: 32,600,521 (GRCm39) V27A probably damaging Het
Cfap69 G T 5: 5,690,230 (GRCm39) probably null Het
Cyp2d11 G T 15: 82,273,498 (GRCm39) L458I probably damaging Het
Dchs1 T C 7: 105,408,138 (GRCm39) E1898G probably damaging Het
Dennd4b G T 3: 90,178,177 (GRCm39) L456F probably damaging Het
Dgat1 T C 15: 76,395,786 (GRCm39) T66A probably benign Het
Dock10 C A 1: 80,583,881 (GRCm39) probably null Het
Fam110b A G 4: 5,799,578 (GRCm39) D332G possibly damaging Het
Fem1al A C 11: 29,773,994 (GRCm39) Y488D probably benign Het
Frmd4b G A 6: 97,273,347 (GRCm39) P628S probably damaging Het
Il17ra T C 6: 120,450,751 (GRCm39) V116A probably damaging Het
Ints9 T C 14: 65,232,460 (GRCm39) I173T probably benign Het
Kctd14 A T 7: 97,107,074 (GRCm39) M110L probably benign Het
Krt6a T G 15: 101,602,637 (GRCm39) Y16S probably benign Het
Lamc2 T C 1: 153,006,502 (GRCm39) N883S probably benign Het
Larp4b C T 13: 9,195,486 (GRCm39) T195M probably damaging Het
Lrp1 A G 10: 127,375,398 (GRCm39) L4432P probably damaging Het
Mei4 T C 9: 81,772,252 (GRCm39) S22P probably damaging Het
Mep1a T C 17: 43,802,527 (GRCm39) Q166R probably damaging Het
Mroh2b C A 15: 4,980,612 (GRCm39) probably null Het
Myoc T G 1: 162,476,220 (GRCm39) L308R probably damaging Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Or1j21 A T 2: 36,684,155 (GRCm39) R302S probably null Het
Or2t6 T A 14: 14,175,725 (GRCm38) Y119F probably damaging Het
Or4c101 C G 2: 88,389,985 (GRCm39) S57R probably damaging Het
Pdilt T A 7: 119,087,217 (GRCm39) T478S probably damaging Het
Pias1 T C 9: 62,827,769 (GRCm39) K222E probably damaging Het
Prss16 A C 13: 22,193,613 (GRCm39) L61V possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Pvr G A 7: 19,644,551 (GRCm39) Q328* probably null Het
Ranbp3 A G 17: 57,017,865 (GRCm39) D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,115 (GRCm39) probably benign Het
Ryr3 G T 2: 112,508,435 (GRCm39) D3419E probably damaging Het
Scn1a C T 2: 66,149,806 (GRCm39) W946* probably null Het
Sh3pxd2a T C 19: 47,266,864 (GRCm39) K242E probably damaging Het
Slc34a2 A G 5: 53,226,848 (GRCm39) D657G probably benign Het
Stard9 T A 2: 120,532,533 (GRCm39) I2930K probably benign Het
Syna T C 5: 134,588,112 (GRCm39) D279G probably benign Het
Tfr2 T C 5: 137,577,292 (GRCm39) F415L probably benign Het
Tmem97 T A 11: 78,433,586 (GRCm39) Y103F probably damaging Het
Tmem97 A T 11: 78,433,587 (GRCm39) Y103N probably damaging Het
Txndc2 T A 17: 65,945,310 (GRCm39) D289V probably damaging Het
Zbtb1 T G 12: 76,433,206 (GRCm39) D397E probably benign Het
Zc3h18 T C 8: 123,140,677 (GRCm39) S847P probably benign Het
Zfp382 G A 7: 29,833,144 (GRCm39) G265E probably damaging Het
Zfp410 T C 12: 84,369,740 (GRCm39) L39S probably damaging Het
Zfp729a G T 13: 67,767,440 (GRCm39) P930T probably benign Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R5914:Ice1 UTSW 13 70,754,496 (GRCm39) missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGGTTTCGCCAAGACACAG -3'
(R):5'- ATGGCACCGCAGTGATGTCCTAAG -3'

Sequencing Primer
(F):5'- GTTTCGCCAAGACACAGATACTTC -3'
(R):5'- AGAGCTTCCTCAGAGTACCAG -3'
Posted On 2014-04-13