Incidental Mutation 'R1525:Olfr720'
ID167806
Institutional Source Beutler Lab
Gene Symbol Olfr720
Ensembl Gene ENSMUSG00000052417
Gene Nameolfactory receptor 720
SynonymsMOR274-2, GA_x6K02T2PLTE-6544896-6543946
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1525 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location14171738-14186838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14175725 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 119 (Y119F)
Ref Sequence ENSEMBL: ENSMUSP00000149641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035250] [ENSMUST00000206298] [ENSMUST00000216079] [ENSMUST00000217642]
Predicted Effect probably damaging
Transcript: ENSMUST00000035250
AA Change: Y119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046509
Gene: ENSMUSG00000052417
AA Change: Y119F

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.4e-49 PFAM
Pfam:7tm_1 40 289 8.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206298
AA Change: Y119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216079
AA Change: Y119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217642
AA Change: Y119F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Cyp2d11 G T 15: 82,389,297 L458I probably damaging Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Ints9 T C 14: 64,995,011 I173T probably benign Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mep1a T C 17: 43,491,636 Q166R probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr1188 C G 2: 88,559,641 S57R probably damaging Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Pdilt T A 7: 119,487,994 T478S probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Ranbp3 A G 17: 56,710,865 D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Olfr720
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02658:Olfr720 APN 14 14175732 missense possibly damaging 0.92
IGL02704:Olfr720 APN 14 14175483 missense probably benign 0.00
IGL03308:Olfr720 APN 14 14175161 missense probably benign
IGL03331:Olfr720 APN 14 14176017 missense probably benign 0.16
R0008:Olfr720 UTSW 14 14176092 start gained probably benign
R0131:Olfr720 UTSW 14 14175620 missense probably benign 0.03
R0647:Olfr720 UTSW 14 14175858 missense probably benign 0.35
R0747:Olfr720 UTSW 14 14175429 missense probably benign 0.01
R1210:Olfr720 UTSW 14 14176029 missense probably benign 0.00
R1225:Olfr720 UTSW 14 14175600 missense possibly damaging 0.89
R1975:Olfr720 UTSW 14 14175446 missense probably damaging 1.00
R1994:Olfr720 UTSW 14 14175854 missense probably benign 0.16
R2310:Olfr720 UTSW 14 14175836 missense probably benign 0.03
R3151:Olfr720 UTSW 14 14175203 missense probably damaging 1.00
R4547:Olfr720 UTSW 14 14175854 missense probably damaging 0.99
R4824:Olfr720 UTSW 14 14175885 missense probably damaging 1.00
R5063:Olfr720 UTSW 14 14175593 missense probably damaging 1.00
R5098:Olfr720 UTSW 14 14175683 missense probably benign 0.03
R5430:Olfr720 UTSW 14 14175692 missense probably benign 0.03
R5512:Olfr720 UTSW 14 14175633 missense probably damaging 1.00
R5748:Olfr720 UTSW 14 14175314 missense probably damaging 1.00
R7200:Olfr720 UTSW 14 14175477 missense probably damaging 1.00
R7407:Olfr720 UTSW 14 14175402 missense probably benign
R7666:Olfr720 UTSW 14 14176075 missense probably benign
R7760:Olfr720 UTSW 14 14175905 missense probably damaging 1.00
R8118:Olfr720 UTSW 14 14175863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGGCAAAAGCCTTCTTCCTC -3'
(R):5'- CCAGTGACTTCACCTTTGTGGGAC -3'

Sequencing Primer
(F):5'- CTGTGACCAGTATCTGGGCATAAG -3'
(R):5'- AAAGCCTCAGGATTCCTGTTCAG -3'
Posted On2014-04-13