Incidental Mutation 'R1525:Mep1a'
ID 167815
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Name meprin 1 alpha
Synonyms Mep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1525 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 43474324-43502812 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43491636 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 166 (Q166R)
Ref Sequence ENSEMBL: ENSMUSP00000113838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
AlphaFold P28825
Predicted Effect probably damaging
Transcript: ENSMUST00000024707
AA Change: Q179R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914
AA Change: Q179R

transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117137
AA Change: Q166R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914
AA Change: Q166R

signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Cyp2d11 G T 15: 82,389,297 L458I probably damaging Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Ints9 T C 14: 64,995,011 I173T probably benign Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr1188 C G 2: 88,559,641 S57R probably damaging Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Olfr720 T A 14: 14,175,725 Y119F probably damaging Het
Pdilt T A 7: 119,487,994 T478S probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Ranbp3 A G 17: 56,710,865 D481G possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4598:Mep1a UTSW 17 43491578 critical splice donor site probably null
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
R7660:Mep1a UTSW 17 43478977 missense probably benign 0.29
R7685:Mep1a UTSW 17 43479174 missense probably benign 0.00
R7703:Mep1a UTSW 17 43478106 missense possibly damaging 0.69
R7871:Mep1a UTSW 17 43479235 missense probably benign 0.33
R8131:Mep1a UTSW 17 43502667 missense probably benign 0.00
R8783:Mep1a UTSW 17 43478190 missense probably benign 0.00
R8880:Mep1a UTSW 17 43497917 missense possibly damaging 0.46
RF010:Mep1a UTSW 17 43486235 missense probably damaging 0.99
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Z1176:Mep1a UTSW 17 43477320 missense probably benign 0.08
Z1177:Mep1a UTSW 17 43486297 missense probably damaging 1.00
Z1177:Mep1a UTSW 17 43486306 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cactaagcaatctcccagcc -3'
Posted On 2014-04-13