Incidental Mutation 'R1525:Ranbp3'
ID 167816
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene Name RAN binding protein 3
Synonyms 2610024N24Rik
MMRRC Submission 040872-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock # R1525 (G1)
Quality Score 157
Status Not validated
Chromosome 17
Chromosomal Location 56673225-56711769 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 56710865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 481 (D481G)
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445] [ENSMUST00000067931] [ENSMUST00000164907]
AlphaFold Q9CT10
Predicted Effect possibly damaging
Transcript: ENSMUST00000002445
AA Change: D481G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372
AA Change: D481G

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067931
SMART Domains Protein: ENSMUSP00000064120
Gene: ENSMUSG00000054723

DomainStartEndE-ValueType
coiled coil region 7 45 N/A INTRINSIC
low complexity region 112 132 N/A INTRINSIC
low complexity region 140 150 N/A INTRINSIC
low complexity region 159 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164907
SMART Domains Protein: ENSMUSP00000132817
Gene: ENSMUSG00000054723

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 48 58 N/A INTRINSIC
low complexity region 67 74 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
4931440F15Rik A C 11: 29,823,994 Y488D probably benign Het
Abcc3 A T 11: 94,361,236 H840Q probably benign Het
Amotl2 C T 9: 102,728,568 R540C probably damaging Het
Brpf1 A G 6: 113,317,154 E605G probably damaging Het
Cacna2d3 T C 14: 28,972,242 I865V probably benign Het
Cdh24 A T 14: 54,638,589 F199I probably damaging Het
Cdk9 A G 2: 32,710,509 V27A probably damaging Het
Cfap69 G T 5: 5,640,230 probably null Het
Cyp2d11 G T 15: 82,389,297 L458I probably damaging Het
Dchs1 T C 7: 105,758,931 E1898G probably damaging Het
Dennd4b G T 3: 90,270,870 L456F probably damaging Het
Dgat1 T C 15: 76,511,586 T66A probably benign Het
Dock10 C A 1: 80,606,164 probably null Het
Fam110b A G 4: 5,799,578 D332G possibly damaging Het
Frmd4b G A 6: 97,296,386 P628S probably damaging Het
Ice1 A T 13: 70,605,410 H852Q probably benign Het
Il17ra T C 6: 120,473,790 V116A probably damaging Het
Ints9 T C 14: 64,995,011 I173T probably benign Het
Kctd14 A T 7: 97,457,867 M110L probably benign Het
Krt6a T G 15: 101,694,202 Y16S probably benign Het
Lamc2 T C 1: 153,130,756 N883S probably benign Het
Larp4b C T 13: 9,145,450 T195M probably damaging Het
Lrp1 A G 10: 127,539,529 L4432P probably damaging Het
Mei4 T C 9: 81,890,199 S22P probably damaging Het
Mep1a T C 17: 43,491,636 Q166R probably damaging Het
Mroh2b C A 15: 4,951,130 probably null Het
Myoc T G 1: 162,648,651 L308R probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Olfr1188 C G 2: 88,559,641 S57R probably damaging Het
Olfr50 A T 2: 36,794,143 R302S probably null Het
Olfr720 T A 14: 14,175,725 Y119F probably damaging Het
Pdilt T A 7: 119,487,994 T478S probably damaging Het
Pias1 T C 9: 62,920,487 K222E probably damaging Het
Prss16 A C 13: 22,009,443 L61V possibly damaging Het
Pvr G A 7: 19,910,626 Q328* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,908 probably benign Het
Ryr3 G T 2: 112,678,090 D3419E probably damaging Het
Scn1a C T 2: 66,319,462 W946* probably null Het
Sh3pxd2a T C 19: 47,278,425 K242E probably damaging Het
Slc34a2 A G 5: 53,069,506 D657G probably benign Het
Stard9 T A 2: 120,702,052 I2930K probably benign Het
Syna T C 5: 134,559,258 D279G probably benign Het
Tfr2 T C 5: 137,579,030 F415L probably benign Het
Tmem97 T A 11: 78,542,760 Y103F probably damaging Het
Tmem97 A T 11: 78,542,761 Y103N probably damaging Het
Txndc2 T A 17: 65,638,315 D289V probably damaging Het
Zbtb1 T G 12: 76,386,432 D397E probably benign Het
Zc3h18 T C 8: 122,413,938 S847P probably benign Het
Zfp382 G A 7: 30,133,719 G265E probably damaging Het
Zfp410 T C 12: 84,322,966 L39S probably damaging Het
Zfp729a G T 13: 67,619,321 P930T probably benign Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 56709238 missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 56710766 missense probably benign
IGL03004:Ranbp3 APN 17 56707207 missense probably damaging 1.00
Waif UTSW 17 56677208 splice site probably null
R0094:Ranbp3 UTSW 17 56709338 unclassified probably benign
R0139:Ranbp3 UTSW 17 56709272 missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 56707169 missense probably benign
R0629:Ranbp3 UTSW 17 56708200 missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 56702896 splice site probably benign
R1495:Ranbp3 UTSW 17 56705527 missense probably benign 0.03
R2044:Ranbp3 UTSW 17 56673367 start gained probably benign
R2093:Ranbp3 UTSW 17 56710145 missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 56696640 critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56673346 start gained probably benign
R5568:Ranbp3 UTSW 17 56701543 critical splice donor site probably null
R5642:Ranbp3 UTSW 17 56710703 missense probably benign 0.01
R5806:Ranbp3 UTSW 17 56710717 missense probably benign 0.01
R5875:Ranbp3 UTSW 17 56707955 critical splice donor site probably null
R6142:Ranbp3 UTSW 17 56686018 missense probably benign 0.33
R6250:Ranbp3 UTSW 17 56677208 splice site probably null
R6745:Ranbp3 UTSW 17 56709308 missense probably benign 0.24
R7222:Ranbp3 UTSW 17 56710211 missense probably damaging 1.00
R7571:Ranbp3 UTSW 17 56707923 missense probably benign 0.01
R7718:Ranbp3 UTSW 17 56696718 missense probably damaging 0.99
R7744:Ranbp3 UTSW 17 56708219 missense possibly damaging 0.92
R8504:Ranbp3 UTSW 17 56708273 missense probably damaging 0.98
R8746:Ranbp3 UTSW 17 56702826 missense probably benign
R9133:Ranbp3 UTSW 17 56696791 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGTATGCTGCACTGCACCACC -3'
(R):5'- AGCTGTGACAAGTGTCAATGTGCC -3'

Sequencing Primer
(F):5'- ACCGCATCCTGGCTCTG -3'
(R):5'- CAATATGATGAGGTCTGAGTCCC -3'
Posted On 2014-04-13