Incidental Mutation 'R1525:Ranbp3'
ID 167816
Institutional Source Beutler Lab
Gene Symbol Ranbp3
Ensembl Gene ENSMUSG00000002372
Gene Name RAN binding protein 3
Synonyms 2610024N24Rik
MMRRC Submission 040872-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R1525 (G1)
Quality Score 157
Status Not validated
Chromosome 17
Chromosomal Location 56980294-57018764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57017865 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 481 (D481G)
Ref Sequence ENSEMBL: ENSMUSP00000002445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002445] [ENSMUST00000067931] [ENSMUST00000164907]
AlphaFold Q9CT10
Predicted Effect possibly damaging
Transcript: ENSMUST00000002445
AA Change: D481G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002445
Gene: ENSMUSG00000002372
AA Change: D481G

DomainStartEndE-ValueType
low complexity region 275 287 N/A INTRINSIC
RanBD 305 432 1.7e-12 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067931
SMART Domains Protein: ENSMUSP00000064120
Gene: ENSMUSG00000054723

DomainStartEndE-ValueType
coiled coil region 7 45 N/A INTRINSIC
low complexity region 112 132 N/A INTRINSIC
low complexity region 140 150 N/A INTRINSIC
low complexity region 159 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164907
SMART Domains Protein: ENSMUSP00000132817
Gene: ENSMUSG00000054723

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
low complexity region 48 58 N/A INTRINSIC
low complexity region 67 74 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a RanBD1 domain that is found in both the nucleus and cytoplasm. This protein plays a role in nuclear export as part of a heteromeric complex. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A T 11: 94,252,062 (GRCm39) H840Q probably benign Het
Amotl2 C T 9: 102,605,767 (GRCm39) R540C probably damaging Het
Brpf1 A G 6: 113,294,115 (GRCm39) E605G probably damaging Het
Cacna2d3 T C 14: 28,694,199 (GRCm39) I865V probably benign Het
Cdh24 A T 14: 54,876,046 (GRCm39) F199I probably damaging Het
Cdk9 A G 2: 32,600,521 (GRCm39) V27A probably damaging Het
Cfap69 G T 5: 5,690,230 (GRCm39) probably null Het
Cyp2d11 G T 15: 82,273,498 (GRCm39) L458I probably damaging Het
Dchs1 T C 7: 105,408,138 (GRCm39) E1898G probably damaging Het
Dennd4b G T 3: 90,178,177 (GRCm39) L456F probably damaging Het
Dgat1 T C 15: 76,395,786 (GRCm39) T66A probably benign Het
Dock10 C A 1: 80,583,881 (GRCm39) probably null Het
Fam110b A G 4: 5,799,578 (GRCm39) D332G possibly damaging Het
Fem1al A C 11: 29,773,994 (GRCm39) Y488D probably benign Het
Frmd4b G A 6: 97,273,347 (GRCm39) P628S probably damaging Het
Ice1 A T 13: 70,753,529 (GRCm39) H852Q probably benign Het
Il17ra T C 6: 120,450,751 (GRCm39) V116A probably damaging Het
Ints9 T C 14: 65,232,460 (GRCm39) I173T probably benign Het
Kctd14 A T 7: 97,107,074 (GRCm39) M110L probably benign Het
Krt6a T G 15: 101,602,637 (GRCm39) Y16S probably benign Het
Lamc2 T C 1: 153,006,502 (GRCm39) N883S probably benign Het
Larp4b C T 13: 9,195,486 (GRCm39) T195M probably damaging Het
Lrp1 A G 10: 127,375,398 (GRCm39) L4432P probably damaging Het
Mei4 T C 9: 81,772,252 (GRCm39) S22P probably damaging Het
Mep1a T C 17: 43,802,527 (GRCm39) Q166R probably damaging Het
Mroh2b C A 15: 4,980,612 (GRCm39) probably null Het
Myoc T G 1: 162,476,220 (GRCm39) L308R probably damaging Het
Ndn C T 7: 61,998,256 (GRCm39) P34L probably benign Het
Or1j21 A T 2: 36,684,155 (GRCm39) R302S probably null Het
Or2t6 T A 14: 14,175,725 (GRCm38) Y119F probably damaging Het
Or4c101 C G 2: 88,389,985 (GRCm39) S57R probably damaging Het
Pdilt T A 7: 119,087,217 (GRCm39) T478S probably damaging Het
Pias1 T C 9: 62,827,769 (GRCm39) K222E probably damaging Het
Prss16 A C 13: 22,193,613 (GRCm39) L61V possibly damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Pvr G A 7: 19,644,551 (GRCm39) Q328* probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,115 (GRCm39) probably benign Het
Ryr3 G T 2: 112,508,435 (GRCm39) D3419E probably damaging Het
Scn1a C T 2: 66,149,806 (GRCm39) W946* probably null Het
Sh3pxd2a T C 19: 47,266,864 (GRCm39) K242E probably damaging Het
Slc34a2 A G 5: 53,226,848 (GRCm39) D657G probably benign Het
Stard9 T A 2: 120,532,533 (GRCm39) I2930K probably benign Het
Syna T C 5: 134,588,112 (GRCm39) D279G probably benign Het
Tfr2 T C 5: 137,577,292 (GRCm39) F415L probably benign Het
Tmem97 T A 11: 78,433,586 (GRCm39) Y103F probably damaging Het
Tmem97 A T 11: 78,433,587 (GRCm39) Y103N probably damaging Het
Txndc2 T A 17: 65,945,310 (GRCm39) D289V probably damaging Het
Zbtb1 T G 12: 76,433,206 (GRCm39) D397E probably benign Het
Zc3h18 T C 8: 123,140,677 (GRCm39) S847P probably benign Het
Zfp382 G A 7: 29,833,144 (GRCm39) G265E probably damaging Het
Zfp410 T C 12: 84,369,740 (GRCm39) L39S probably damaging Het
Zfp729a G T 13: 67,767,440 (GRCm39) P930T probably benign Het
Other mutations in Ranbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ranbp3 APN 17 57,016,238 (GRCm39) missense probably damaging 1.00
IGL02801:Ranbp3 APN 17 57,017,766 (GRCm39) missense probably benign
IGL03004:Ranbp3 APN 17 57,014,207 (GRCm39) missense probably damaging 1.00
Waif UTSW 17 56,984,208 (GRCm39) splice site probably null
R0094:Ranbp3 UTSW 17 57,016,338 (GRCm39) unclassified probably benign
R0139:Ranbp3 UTSW 17 57,016,272 (GRCm39) missense possibly damaging 0.95
R0419:Ranbp3 UTSW 17 57,015,219 (GRCm39) missense possibly damaging 0.92
R0426:Ranbp3 UTSW 17 57,014,169 (GRCm39) missense probably benign
R0629:Ranbp3 UTSW 17 57,015,200 (GRCm39) missense possibly damaging 0.95
R0632:Ranbp3 UTSW 17 57,009,896 (GRCm39) splice site probably benign
R1495:Ranbp3 UTSW 17 57,012,527 (GRCm39) missense probably benign 0.03
R2044:Ranbp3 UTSW 17 56,980,367 (GRCm39) start gained probably benign
R2093:Ranbp3 UTSW 17 57,017,145 (GRCm39) missense probably damaging 1.00
R4649:Ranbp3 UTSW 17 57,003,640 (GRCm39) critical splice donor site probably null
R4780:Ranbp3 UTSW 17 56,980,346 (GRCm39) start gained probably benign
R5568:Ranbp3 UTSW 17 57,008,543 (GRCm39) critical splice donor site probably null
R5642:Ranbp3 UTSW 17 57,017,703 (GRCm39) missense probably benign 0.01
R5806:Ranbp3 UTSW 17 57,017,717 (GRCm39) missense probably benign 0.01
R5875:Ranbp3 UTSW 17 57,014,955 (GRCm39) critical splice donor site probably null
R6142:Ranbp3 UTSW 17 56,993,018 (GRCm39) missense probably benign 0.33
R6250:Ranbp3 UTSW 17 56,984,208 (GRCm39) splice site probably null
R6745:Ranbp3 UTSW 17 57,016,308 (GRCm39) missense probably benign 0.24
R7222:Ranbp3 UTSW 17 57,017,211 (GRCm39) missense probably damaging 1.00
R7571:Ranbp3 UTSW 17 57,014,923 (GRCm39) missense probably benign 0.01
R7718:Ranbp3 UTSW 17 57,003,718 (GRCm39) missense probably damaging 0.99
R7744:Ranbp3 UTSW 17 57,015,219 (GRCm39) missense possibly damaging 0.92
R8504:Ranbp3 UTSW 17 57,015,273 (GRCm39) missense probably damaging 0.98
R8746:Ranbp3 UTSW 17 57,009,826 (GRCm39) missense probably benign
R9133:Ranbp3 UTSW 17 57,003,791 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTGTATGCTGCACTGCACCACC -3'
(R):5'- AGCTGTGACAAGTGTCAATGTGCC -3'

Sequencing Primer
(F):5'- ACCGCATCCTGGCTCTG -3'
(R):5'- CAATATGATGAGGTCTGAGTCCC -3'
Posted On 2014-04-13