Incidental Mutation 'R1510:Daam1'
ID167874
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71977726 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 814 (M814V)
Ref Sequence ENSEMBL: ENSMUSP00000152532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect probably damaging
Transcript: ENSMUST00000085299
AA Change: M823V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: M823V

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000221317
AA Change: M814V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223272
AA Change: M823V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.7507 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5180:Daam1 UTSW 12 71947125 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCGAATGCCTGTTAAGATGTG -3'
(R):5'- GACAGCGTCCCTATGCAGAGAAAG -3'

Sequencing Primer
(F):5'- AAGATGTGTTGCTCTAGGACAG -3'
(R):5'- TCCCTATGCAGAGAAAGTAGATG -3'
Posted On2014-04-13