Mutagenetix > Incidental Mutation

Incidental Mutation 'R1510:Umodl1'

167895

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

039557-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 30959229 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 60 (V60M)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V60M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000066981
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V60M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V60M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Meta Mutation Damage Score

0.2924

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

100% (79/79)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	T	12: 55,304,212	Q102L	probably benign	Het
1700001L19Rik	T	A	13: 68,597,477	M1K	probably null	Het
Abcd2	A	G	15: 91,188,978	L326S	probably damaging	Het
Adam18	T	A	8: 24,625,831	T616S	probably benign	Het
Adam22	T	C	5: 8,152,408	K215E	probably benign	Het
Ahi1	T	G	10: 20,959,800	S11A	probably benign	Het
Asb18	T	C	1: 89,996,254	M96V	possibly damaging	Het
Baz2b	T	C	2: 59,922,209	D1149G	probably damaging	Het
C1qtnf3	A	G	15: 10,975,636	E176G	probably benign	Het
Cd151	T	A	7: 141,470,367	S172T	probably benign	Het
Cdh2	G	T	18: 16,648,594	L90I	probably benign	Het
Cdkl3	T	C	11: 52,033,514	V55A	possibly damaging	Het
Chst8	T	A	7: 34,675,268	H382L	probably benign	Het
Cyb5r4	T	C	9: 87,066,643		probably benign	Het
Cyp2j13	T	C	4: 96,061,972	D264G	possibly damaging	Het
Daam1	A	G	12: 71,977,726	M814V	probably damaging	Het
Ddx19b	A	G	8: 111,015,653	I150T	probably damaging	Het
Dync1li1	T	G	9: 114,689,210	S50A	possibly damaging	Het
Fat3	A	T	9: 15,960,055	L3680Q	probably damaging	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Gm21286	T	G	4: 60,838,932		noncoding transcript	Het
Il6	T	C	5: 30,018,062	Y126H	probably damaging	Het
Inhba	G	T	13: 16,027,022	V390L	probably damaging	Het
Ino80	C	T	2: 119,450,049	R278H	probably damaging	Het
Jade3	T	G	X: 20,517,818	N799K	probably benign	Het
Kcnn1	G	A	8: 70,864,070		probably benign	Het
Klhl6	T	C	16: 19,947,098	T585A	probably damaging	Het
Kmt2d	T	A	15: 98,856,377		probably benign	Het
Krt17	C	T	11: 100,257,539	E359K	possibly damaging	Het
Lce1b	T	G	3: 92,655,976	R83S	unknown	Het
Lck	T	C	4: 129,555,668	S290G	possibly damaging	Het
Ltbp3	T	C	19: 5,748,887	S544P	probably benign	Het
Lypd6b	T	A	2: 49,934,819	S4R	probably damaging	Het
Macf1	T	C	4: 123,434,762	D4724G	probably null	Het
Mcoln2	A	G	3: 146,176,610	T255A	probably benign	Het
Mcph1	T	A	8: 18,632,687		probably null	Het
Mki67	C	A	7: 135,696,171	R2378L	probably benign	Het
Mxd1	A	G	6: 86,653,155	V27A	possibly damaging	Het
Myo5a	T	C	9: 75,171,551	Y864H	probably benign	Het
Ndel1	A	T	11: 68,822,656	N318K	possibly damaging	Het
Oasl1	A	G	5: 114,928,108	Q95R	probably benign	Het
Olfr1052	T	C	2: 86,298,371	L185P	probably damaging	Het
Olfr1415	A	T	1: 92,491,617	I46N	probably damaging	Het
Olfr198	A	T	16: 59,202,183	M81K	probably damaging	Het
Olfr480	T	C	7: 108,066,528	Y60C	probably damaging	Het
Parp10	T	A	15: 76,241,417	Q487L	probably damaging	Het
Pcdh10	C	T	3: 45,379,403	R51C	probably damaging	Het
Pdpr	A	T	8: 111,124,475		probably benign	Het
Pfpl	A	T	19: 12,429,696	D437V	probably benign	Het
Pik3c2a	G	A	7: 116,388,045	T547I	probably benign	Het
Pkdrej	A	C	15: 85,816,762	S1658A	possibly damaging	Het
Pkn3	T	C	2: 30,079,764		probably null	Het
Plekhh2	A	G	17: 84,559,576		probably null	Het
Plxdc1	A	T	11: 97,932,324	C357S	probably damaging	Het
Pnp	A	G	14: 50,950,585	T132A	possibly damaging	Het
Rcan2	A	G	17: 43,836,424	D51G	probably damaging	Het
Rcn1	T	C	2: 105,389,089	N253S	probably damaging	Het
Rreb1	T	A	13: 37,931,884	I1073N	probably benign	Het
Scaf4	G	T	16: 90,245,394	D686E	unknown	Het
Sfxn5	A	C	6: 85,236,925	M221R	probably damaging	Het
Slc38a1	A	G	15: 96,609,860	F104L	probably damaging	Het
Slc8a1	A	T	17: 81,648,118	V497D	probably damaging	Het
Spryd3	C	A	15: 102,118,961	G290C	probably damaging	Het
Stc2	A	T	11: 31,365,418	Y140*	probably null	Het
Stfa2	A	T	16: 36,408,311	I8K	possibly damaging	Het
Sult3a2	A	T	10: 33,782,030	M29K	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Triobp	G	A	15: 79,003,767	R1908Q	probably damaging	Het
Trpm2	T	A	10: 77,966,994	R7*	probably null	Het
Ttn	T	C	2: 76,952,157	I912V	probably benign	Het
Tusc2	T	A	9: 107,564,881	V93E	probably damaging	Het
Uhrf2	T	A	19: 30,039,061		probably benign	Het
Ush2a	A	T	1: 188,648,304	D2270V	probably damaging	Het
Vmn2r80	A	G	10: 79,169,719	T397A	possibly damaging	Het
Wbp2	A	G	11: 116,086,882	V15A	probably benign	Het
Zfp182	T	A	X: 21,030,207	R617W	probably damaging	Het
Zfp82	C	A	7: 30,056,622	R345L	probably damaging	Het
Zfp85	T	C	13: 67,754,965		probably benign	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
Disquieting	UTSW	17	30959155	missense	probably damaging	1.00
floored	UTSW	17	30988057	nonsense	probably null
R7231_umodl1_507	UTSW	17	30986116	missense	probably damaging	1.00
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
G1citation:Umodl1	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R6999:Umodl1	UTSW	17	30999123	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	30986387	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	30983984	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	30973703	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	30959173	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	30966704	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	30998727	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	30996393	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	30998169	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	30998178	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	30959350	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCCAATACTCATACAGGGCACAG -3'
(R):5'- TAGGATTCCAGGGAGACATCGCAG -3'

Sequencing Primer
(F):5'- AGGGCACAGTGATCTGATCC -3'
(R):5'- TTCTCCCTCCAGGGGAAAAG -3'

Posted On

2014-04-13