Incidental Mutation 'R1510:Umodl1'
ID167895
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30959229 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 60 (V60M)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V60M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V60M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V60M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.2924 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
floored UTSW 17 30988057 nonsense probably null
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R6999:Umodl1 UTSW 17 30999123 missense probably damaging 1.00
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7915:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGCCAATACTCATACAGGGCACAG -3'
(R):5'- TAGGATTCCAGGGAGACATCGCAG -3'

Sequencing Primer
(F):5'- AGGGCACAGTGATCTGATCC -3'
(R):5'- TTCTCCCTCCAGGGGAAAAG -3'
Posted On2014-04-13