Incidental Mutation 'R1510:Umodl1'
ID 167895
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Name uromodulin-like 1
Synonyms D17Ertd488e
MMRRC Submission 039557-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1510 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 31173614-31229684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 31178203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 60 (V60M)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
AlphaFold Q5DID3
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: V60M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066981
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: V60M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: V60M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: V60M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Meta Mutation Damage Score 0.2924 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,073,181 (GRCm39) L326S probably damaging Het
Adam18 T A 8: 25,115,847 (GRCm39) T616S probably benign Het
Adam22 T C 5: 8,202,408 (GRCm39) K215E probably benign Het
Ahi1 T G 10: 20,835,699 (GRCm39) S11A probably benign Het
Asb18 T C 1: 89,923,976 (GRCm39) M96V possibly damaging Het
Baz2b T C 2: 59,752,553 (GRCm39) D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,722 (GRCm39) E176G probably benign Het
Cd151 T A 7: 141,050,280 (GRCm39) S172T probably benign Het
Cdh2 G T 18: 16,781,651 (GRCm39) L90I probably benign Het
Cdkl3 T C 11: 51,924,341 (GRCm39) V55A possibly damaging Het
Cfap90 T A 13: 68,745,596 (GRCm39) M1K probably null Het
Chst8 T A 7: 34,374,693 (GRCm39) H382L probably benign Het
Cyb5r4 T C 9: 86,948,696 (GRCm39) probably benign Het
Cyp2j13 T C 4: 95,950,209 (GRCm39) D264G possibly damaging Het
Daam1 A G 12: 72,024,500 (GRCm39) M814V probably damaging Het
Ddx19b A G 8: 111,742,285 (GRCm39) I150T probably damaging Het
Dync1li1 T G 9: 114,518,278 (GRCm39) S50A possibly damaging Het
Fat3 A T 9: 15,871,351 (GRCm39) L3680Q probably damaging Het
Fermt1 C T 2: 132,766,942 (GRCm39) E342K probably benign Het
Gm21286 T G 4: 60,794,931 (GRCm39) noncoding transcript Het
Il6 T C 5: 30,223,060 (GRCm39) Y126H probably damaging Het
Inhba G T 13: 16,201,607 (GRCm39) V390L probably damaging Het
Ino80 C T 2: 119,280,530 (GRCm39) R278H probably damaging Het
Jade3 T G X: 20,384,057 (GRCm39) N799K probably benign Het
Kcnn1 G A 8: 71,316,714 (GRCm39) probably benign Het
Klhl6 T C 16: 19,765,848 (GRCm39) T585A probably damaging Het
Kmt2d T A 15: 98,754,258 (GRCm39) probably benign Het
Krt17 C T 11: 100,148,365 (GRCm39) E359K possibly damaging Het
Lce1b T G 3: 92,563,283 (GRCm39) R83S unknown Het
Lck T C 4: 129,449,461 (GRCm39) S290G possibly damaging Het
Ltbp3 T C 19: 5,798,915 (GRCm39) S544P probably benign Het
Lypd6b T A 2: 49,824,831 (GRCm39) S4R probably damaging Het
Macf1 T C 4: 123,328,555 (GRCm39) D4724G probably null Het
Mcoln2 A G 3: 145,882,365 (GRCm39) T255A probably benign Het
Mcph1 T A 8: 18,682,703 (GRCm39) probably null Het
Mki67 C A 7: 135,297,900 (GRCm39) R2378L probably benign Het
Mxd1 A G 6: 86,630,137 (GRCm39) V27A possibly damaging Het
Myo5a T C 9: 75,078,833 (GRCm39) Y864H probably benign Het
Ndel1 A T 11: 68,713,482 (GRCm39) N318K possibly damaging Het
Oasl1 A G 5: 115,066,167 (GRCm39) Q95R probably benign Het
Or5ac16 A T 16: 59,022,546 (GRCm39) M81K probably damaging Het
Or5j3 T C 2: 86,128,715 (GRCm39) L185P probably damaging Het
Or5p57 T C 7: 107,665,735 (GRCm39) Y60C probably damaging Het
Or6b2b A T 1: 92,419,339 (GRCm39) I46N probably damaging Het
Parp10 T A 15: 76,125,617 (GRCm39) Q487L probably damaging Het
Pcdh10 C T 3: 45,333,838 (GRCm39) R51C probably damaging Het
Pdpr A T 8: 111,851,107 (GRCm39) probably benign Het
Pfpl A T 19: 12,407,060 (GRCm39) D437V probably benign Het
Pik3c2a G A 7: 115,987,280 (GRCm39) T547I probably benign Het
Pkdrej A C 15: 85,700,963 (GRCm39) S1658A possibly damaging Het
Pkn3 T C 2: 29,969,776 (GRCm39) probably null Het
Plekhh2 A G 17: 84,867,004 (GRCm39) probably null Het
Plxdc1 A T 11: 97,823,150 (GRCm39) C357S probably damaging Het
Pnp A G 14: 51,188,042 (GRCm39) T132A possibly damaging Het
Prorp A T 12: 55,350,997 (GRCm39) Q102L probably benign Het
Rcan2 A G 17: 44,147,315 (GRCm39) D51G probably damaging Het
Rcn1 T C 2: 105,219,434 (GRCm39) N253S probably damaging Het
Rreb1 T A 13: 38,115,860 (GRCm39) I1073N probably benign Het
Scaf4 G T 16: 90,042,282 (GRCm39) D686E unknown Het
Sfxn5 A C 6: 85,213,907 (GRCm39) M221R probably damaging Het
Slc38a1 A G 15: 96,507,741 (GRCm39) F104L probably damaging Het
Slc8a1 A T 17: 81,955,547 (GRCm39) V497D probably damaging Het
Spryd3 C A 15: 102,027,396 (GRCm39) G290C probably damaging Het
Stc2 A T 11: 31,315,418 (GRCm39) Y140* probably null Het
Stfa2 A T 16: 36,228,673 (GRCm39) I8K possibly damaging Het
Sult3a2 A T 10: 33,658,026 (GRCm39) M29K probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Triobp G A 15: 78,887,967 (GRCm39) R1908Q probably damaging Het
Trpm2 T A 10: 77,802,828 (GRCm39) R7* probably null Het
Ttn T C 2: 76,782,501 (GRCm39) I912V probably benign Het
Tusc2 T A 9: 107,442,080 (GRCm39) V93E probably damaging Het
Uhrf2 T A 19: 30,016,461 (GRCm39) probably benign Het
Ush2a A T 1: 188,380,501 (GRCm39) D2270V probably damaging Het
Vmn2r80 A G 10: 79,005,553 (GRCm39) T397A possibly damaging Het
Wbp2 A G 11: 115,977,708 (GRCm39) V15A probably benign Het
Zfp182 T A X: 20,896,446 (GRCm39) R617W probably damaging Het
Zfp82 C A 7: 29,756,047 (GRCm39) R345L probably damaging Het
Zfp85 T C 13: 67,903,084 (GRCm39) probably benign Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31,227,724 (GRCm39) utr 3 prime probably benign
IGL01344:Umodl1 APN 17 31,215,238 (GRCm39) missense probably damaging 0.99
IGL01529:Umodl1 APN 17 31,215,233 (GRCm39) missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 31,217,800 (GRCm39) missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 31,215,229 (GRCm39) missense probably benign 0.00
IGL01877:Umodl1 APN 17 31,201,294 (GRCm39) missense probably benign 0.00
IGL01977:Umodl1 APN 17 31,192,742 (GRCm39) missense probably damaging 0.99
IGL02063:Umodl1 APN 17 31,206,888 (GRCm39) missense probably benign 0.07
IGL02160:Umodl1 APN 17 31,205,091 (GRCm39) missense probably damaging 0.97
IGL02252:Umodl1 APN 17 31,213,789 (GRCm39) critical splice donor site probably null
IGL02427:Umodl1 APN 17 31,187,415 (GRCm39) splice site probably benign
IGL02496:Umodl1 APN 17 31,217,628 (GRCm39) missense probably damaging 0.99
IGL02633:Umodl1 APN 17 31,208,462 (GRCm39) missense probably damaging 1.00
IGL03271:Umodl1 APN 17 31,205,473 (GRCm39) nonsense probably null
IGL03392:Umodl1 APN 17 31,215,329 (GRCm39) missense probably damaging 0.98
Disquieting UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
floored UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7231_umodl1_507 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
surprising UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
unsettling UTSW 17 31,205,528 (GRCm39) nonsense probably null
G1citation:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
PIT4468001:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0048:Umodl1 UTSW 17 31,187,451 (GRCm39) missense probably damaging 1.00
R0653:Umodl1 UTSW 17 31,203,002 (GRCm39) missense probably benign 0.00
R0831:Umodl1 UTSW 17 31,215,325 (GRCm39) missense probably damaging 1.00
R1078:Umodl1 UTSW 17 31,178,347 (GRCm39) missense probably benign 0.00
R1166:Umodl1 UTSW 17 31,221,772 (GRCm39) splice site probably benign
R1231:Umodl1 UTSW 17 31,178,252 (GRCm39) missense probably damaging 1.00
R1459:Umodl1 UTSW 17 31,205,478 (GRCm39) missense probably benign 0.05
R1459:Umodl1 UTSW 17 31,201,232 (GRCm39) splice site probably benign
R1654:Umodl1 UTSW 17 31,206,942 (GRCm39) missense probably benign
R1757:Umodl1 UTSW 17 31,227,674 (GRCm39) missense probably damaging 0.99
R1781:Umodl1 UTSW 17 31,187,524 (GRCm39) missense probably damaging 1.00
R1873:Umodl1 UTSW 17 31,201,238 (GRCm39) missense probably damaging 0.99
R1911:Umodl1 UTSW 17 31,211,128 (GRCm39) missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R1918:Umodl1 UTSW 17 31,203,017 (GRCm39) missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2058:Umodl1 UTSW 17 31,227,740 (GRCm39) critical splice donor site probably null
R2089:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2091:Umodl1 UTSW 17 31,190,893 (GRCm39) missense probably benign 0.00
R2431:Umodl1 UTSW 17 31,211,062 (GRCm39) missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 31,211,147 (GRCm39) missense probably damaging 1.00
R3032:Umodl1 UTSW 17 31,208,502 (GRCm39) missense probably benign 0.01
R3956:Umodl1 UTSW 17 31,221,837 (GRCm39) missense probably benign 0.10
R3975:Umodl1 UTSW 17 31,203,763 (GRCm39) nonsense probably null
R4207:Umodl1 UTSW 17 31,178,341 (GRCm39) missense probably damaging 1.00
R4287:Umodl1 UTSW 17 31,207,039 (GRCm39) missense probably benign 0.11
R4452:Umodl1 UTSW 17 31,213,789 (GRCm39) critical splice donor site probably null
R4684:Umodl1 UTSW 17 31,217,088 (GRCm39) missense probably benign 0.00
R4769:Umodl1 UTSW 17 31,202,976 (GRCm39) missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R4888:Umodl1 UTSW 17 31,218,175 (GRCm39) missense probably damaging 1.00
R4978:Umodl1 UTSW 17 31,205,055 (GRCm39) missense probably benign
R4993:Umodl1 UTSW 17 31,205,459 (GRCm39) missense probably benign 0.00
R5241:Umodl1 UTSW 17 31,203,066 (GRCm39) missense probably benign 0.18
R5254:Umodl1 UTSW 17 31,199,333 (GRCm39) missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 31,205,439 (GRCm39) missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 31,201,263 (GRCm39) missense probably benign 0.04
R5754:Umodl1 UTSW 17 31,213,761 (GRCm39) missense probably damaging 0.96
R6189:Umodl1 UTSW 17 31,215,256 (GRCm39) missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31,221,866 (GRCm39) critical splice donor site probably null
R6289:Umodl1 UTSW 17 31,201,325 (GRCm39) missense probably benign 0.16
R6432:Umodl1 UTSW 17 31,205,121 (GRCm39) missense probably benign 0.38
R6478:Umodl1 UTSW 17 31,178,129 (GRCm39) missense probably damaging 1.00
R6702:Umodl1 UTSW 17 31,205,273 (GRCm39) splice site probably null
R6822:Umodl1 UTSW 17 31,205,528 (GRCm39) nonsense probably null
R6999:Umodl1 UTSW 17 31,218,097 (GRCm39) missense probably damaging 1.00
R7067:Umodl1 UTSW 17 31,201,246 (GRCm39) missense probably damaging 1.00
R7123:Umodl1 UTSW 17 31,201,318 (GRCm39) missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 31,201,236 (GRCm39) critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 31,205,090 (GRCm39) missense probably damaging 1.00
R7234:Umodl1 UTSW 17 31,205,595 (GRCm39) missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31,227,639 (GRCm39) missense probably benign 0.06
R7392:Umodl1 UTSW 17 31,201,306 (GRCm39) missense probably damaging 0.99
R7401:Umodl1 UTSW 17 31,217,122 (GRCm39) missense probably damaging 1.00
R7461:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7594:Umodl1 UTSW 17 31,173,779 (GRCm39) missense probably benign 0.02
R7613:Umodl1 UTSW 17 31,207,031 (GRCm39) nonsense probably null
R7763:Umodl1 UTSW 17 31,205,430 (GRCm39) missense probably benign 0.24
R7797:Umodl1 UTSW 17 31,178,125 (GRCm39) missense probably benign 0.02
R7832:Umodl1 UTSW 17 31,192,666 (GRCm39) critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 31,205,361 (GRCm39) missense probably benign 0.00
R8088:Umodl1 UTSW 17 31,192,770 (GRCm39) missense probably benign 0.29
R8111:Umodl1 UTSW 17 31,190,792 (GRCm39) missense probably damaging 0.99
R8314:Umodl1 UTSW 17 31,203,806 (GRCm39) missense probably damaging 0.99
R8826:Umodl1 UTSW 17 31,202,958 (GRCm39) missense possibly damaging 0.65
R9067:Umodl1 UTSW 17 31,192,677 (GRCm39) missense probably damaging 1.00
R9091:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9099:Umodl1 UTSW 17 31,178,147 (GRCm39) missense probably benign 0.01
R9270:Umodl1 UTSW 17 31,185,678 (GRCm39) missense probably damaging 1.00
R9341:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9343:Umodl1 UTSW 17 31,217,701 (GRCm39) missense possibly damaging 0.95
R9400:Umodl1 UTSW 17 31,215,367 (GRCm39) missense probably damaging 0.99
R9569:Umodl1 UTSW 17 31,217,143 (GRCm39) missense probably damaging 1.00
R9615:Umodl1 UTSW 17 31,217,152 (GRCm39) missense possibly damaging 0.94
R9787:Umodl1 UTSW 17 31,178,324 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAATACTCATACAGGGCACAG -3'
(R):5'- TAGGATTCCAGGGAGACATCGCAG -3'

Sequencing Primer
(F):5'- AGGGCACAGTGATCTGATCC -3'
(R):5'- TTCTCCCTCCAGGGGAAAAG -3'
Posted On 2014-04-13