Incidental Mutation 'R1510:Slc8a1'
ID167897
Institutional Source Beutler Lab
Gene Symbol Slc8a1
Ensembl Gene ENSMUSG00000054640
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 1
SynonymsNcx1, D930008O12Rik
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location81388691-81649607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81648118 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 497 (V497D)
Ref Sequence ENSEMBL: ENSMUSP00000083725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086538] [ENSMUST00000163123] [ENSMUST00000163680]
Predicted Effect probably damaging
Transcript: ENSMUST00000086538
AA Change: V497D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083725
Gene: ENSMUSG00000054640
AA Change: V497D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163123
AA Change: V497D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132809
Gene: ENSMUSG00000054640
AA Change: V497D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 87 246 4.6e-38 PFAM
coiled coil region 313 332 N/A INTRINSIC
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 742 753 N/A INTRINSIC
Pfam:Na_Ca_ex 794 947 1.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163680
AA Change: V497D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126373
Gene: ENSMUSG00000054640
AA Change: V497D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 77 248 3.8e-38 PFAM
Pfam:Na_Ca_ex_C 251 386 2e-53 PFAM
Calx_beta 393 493 1.28e-49 SMART
Calx_beta 524 624 8.25e-44 SMART
low complexity region 754 765 N/A INTRINSIC
Pfam:Na_Ca_ex 796 961 2.4e-29 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In cardiac myocytes, Ca(2+) concentrations alternate between high levels during contraction and low levels during relaxation. The increase in Ca(2+) concentration during contraction is primarily due to release of Ca(2+) from intracellular stores. However, some Ca(2+) also enters the cell through the sarcolemma (plasma membrane). During relaxation, Ca(2+) is sequestered within the intracellular stores. To prevent overloading of intracellular stores, the Ca(2+) that entered across the sarcolemma must be extruded from the cell. The Na(+)-Ca(2+) exchanger is the primary mechanism by which the Ca(2+) is extruded from the cell during relaxation. In the heart, the exchanger may play a key role in digitalis action. The exchanger is the dominant mechanism in returning the cardiac myocyte to its resting state following excitation.[supplied by OMIM, Apr 2004]
PHENOTYPE: Homozygotes for targeted null mutations have underdeveloped, nonbeating hearts with massive apoptosis of myocytes, a dilated pericardium and die around embryonic day 9.5. Heterozygotes exhibit altered responses to experimental cardiac pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plekhh2 A G 17: 84,559,576 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Slc8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Slc8a1 APN 17 81649171 missense probably damaging 1.00
IGL00572:Slc8a1 APN 17 81388726 missense probably damaging 1.00
IGL00777:Slc8a1 APN 17 81648580 missense probably damaging 1.00
IGL00857:Slc8a1 APN 17 81647879 missense probably benign 0.03
IGL01068:Slc8a1 APN 17 81388942 missense probably benign 0.09
IGL01089:Slc8a1 APN 17 81648281 missense probably damaging 1.00
IGL01089:Slc8a1 APN 17 81388881 missense probably damaging 1.00
IGL01510:Slc8a1 APN 17 81648365 missense probably damaging 1.00
IGL01677:Slc8a1 APN 17 81648607 missense probably damaging 1.00
IGL01862:Slc8a1 APN 17 81442201 critical splice donor site probably null
IGL02003:Slc8a1 APN 17 81428196 missense possibly damaging 0.80
IGL02500:Slc8a1 APN 17 81388713 missense probably damaging 1.00
IGL02556:Slc8a1 APN 17 81648744 missense probably benign 0.24
IGL02800:Slc8a1 APN 17 81408323 missense probably benign 0.01
IGL03308:Slc8a1 APN 17 81442195 unclassified probably benign
IGL03391:Slc8a1 APN 17 81432638 splice site probably benign
cardinal UTSW 17 81648407 missense probably damaging 0.99
encyclical UTSW 17 81649454 missense probably damaging 1.00
PIT4498001:Slc8a1 UTSW 17 81648840 nonsense probably null
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0067:Slc8a1 UTSW 17 81437759 missense probably benign 0.00
R0485:Slc8a1 UTSW 17 81647993 missense probably damaging 0.99
R0667:Slc8a1 UTSW 17 81648881 missense probably damaging 1.00
R0845:Slc8a1 UTSW 17 81437748 missense probably benign 0.05
R1073:Slc8a1 UTSW 17 81648407 missense probably damaging 0.99
R1417:Slc8a1 UTSW 17 81408280 missense probably damaging 1.00
R1546:Slc8a1 UTSW 17 81648247 missense probably damaging 1.00
R1625:Slc8a1 UTSW 17 81649241 missense probably damaging 1.00
R1806:Slc8a1 UTSW 17 81648487 missense probably damaging 1.00
R1879:Slc8a1 UTSW 17 81648013 missense probably damaging 1.00
R2025:Slc8a1 UTSW 17 81649112 missense probably damaging 1.00
R2187:Slc8a1 UTSW 17 81648553 missense possibly damaging 0.48
R2198:Slc8a1 UTSW 17 81408256 nonsense probably null
R3856:Slc8a1 UTSW 17 81648374 missense probably benign
R4067:Slc8a1 UTSW 17 81648274 missense probably damaging 1.00
R4224:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R4225:Slc8a1 UTSW 17 81649352 missense probably damaging 1.00
R5028:Slc8a1 UTSW 17 81649273 missense possibly damaging 0.91
R5307:Slc8a1 UTSW 17 81649224 missense probably damaging 1.00
R5766:Slc8a1 UTSW 17 81648961 missense probably damaging 0.97
R5787:Slc8a1 UTSW 17 81388737 missense probably damaging 1.00
R5902:Slc8a1 UTSW 17 81408082 missense probably damaging 1.00
R5913:Slc8a1 UTSW 17 81648002 missense probably damaging 1.00
R6017:Slc8a1 UTSW 17 81648254 missense probably damaging 1.00
R6481:Slc8a1 UTSW 17 81388918 missense probably benign
R6670:Slc8a1 UTSW 17 81649454 missense probably damaging 1.00
R6714:Slc8a1 UTSW 17 81408249 missense probably damaging 1.00
R6914:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R6919:Slc8a1 UTSW 17 81388872 missense probably damaging 1.00
R6942:Slc8a1 UTSW 17 81408120 missense probably damaging 1.00
R7057:Slc8a1 UTSW 17 81649095 missense probably damaging 1.00
R7431:Slc8a1 UTSW 17 81441663 missense probably benign 0.00
R7447:Slc8a1 UTSW 17 81649006 missense probably damaging 1.00
R7480:Slc8a1 UTSW 17 81649220 missense probably damaging 1.00
R7572:Slc8a1 UTSW 17 81441771 critical splice donor site probably null
R8056:Slc8a1 UTSW 17 81647923 missense probably damaging 1.00
X0024:Slc8a1 UTSW 17 81432762 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGATGCCAATGCTCTCGCTCAC -3'
(R):5'- GGCTGAAAACGACCCAGTCAGTAAG -3'

Sequencing Primer
(F):5'- ACGTGAGTCACGGGTTCC -3'
(R):5'- CATACCAGTGTCTAGAGAACTGTG -3'
Posted On2014-04-13