Incidental Mutation 'R1510:Plekhh2'
ID167898
Institutional Source Beutler Lab
Gene Symbol Plekhh2
Ensembl Gene ENSMUSG00000040852
Gene Namepleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Synonyms
MMRRC Submission 039557-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1510 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84511895-84622142 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 84559576 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039628 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047206]
Predicted Effect probably null
Transcript: ENSMUST00000047206
SMART Domains Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852

DomainStartEndE-ValueType
coiled coil region 19 84 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
coiled coil region 137 174 N/A INTRINSIC
low complexity region 427 442 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
low complexity region 612 651 N/A INTRINSIC
low complexity region 657 666 N/A INTRINSIC
PH 703 798 4.7e-19 SMART
PH 811 920 1.15e-4 SMART
MyTH4 954 1109 8.49e-39 SMART
B41 1116 1353 1.01e-27 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,304,212 Q102L probably benign Het
1700001L19Rik T A 13: 68,597,477 M1K probably null Het
Abcd2 A G 15: 91,188,978 L326S probably damaging Het
Adam18 T A 8: 24,625,831 T616S probably benign Het
Adam22 T C 5: 8,152,408 K215E probably benign Het
Ahi1 T G 10: 20,959,800 S11A probably benign Het
Asb18 T C 1: 89,996,254 M96V possibly damaging Het
Baz2b T C 2: 59,922,209 D1149G probably damaging Het
C1qtnf3 A G 15: 10,975,636 E176G probably benign Het
Cd151 T A 7: 141,470,367 S172T probably benign Het
Cdh2 G T 18: 16,648,594 L90I probably benign Het
Cdkl3 T C 11: 52,033,514 V55A possibly damaging Het
Chst8 T A 7: 34,675,268 H382L probably benign Het
Cyb5r4 T C 9: 87,066,643 probably benign Het
Cyp2j13 T C 4: 96,061,972 D264G possibly damaging Het
Daam1 A G 12: 71,977,726 M814V probably damaging Het
Ddx19b A G 8: 111,015,653 I150T probably damaging Het
Dync1li1 T G 9: 114,689,210 S50A possibly damaging Het
Fat3 A T 9: 15,960,055 L3680Q probably damaging Het
Fermt1 C T 2: 132,925,022 E342K probably benign Het
Gm21286 T G 4: 60,838,932 noncoding transcript Het
Il6 T C 5: 30,018,062 Y126H probably damaging Het
Inhba G T 13: 16,027,022 V390L probably damaging Het
Ino80 C T 2: 119,450,049 R278H probably damaging Het
Jade3 T G X: 20,517,818 N799K probably benign Het
Kcnn1 G A 8: 70,864,070 probably benign Het
Klhl6 T C 16: 19,947,098 T585A probably damaging Het
Kmt2d T A 15: 98,856,377 probably benign Het
Krt17 C T 11: 100,257,539 E359K possibly damaging Het
Lce1b T G 3: 92,655,976 R83S unknown Het
Lck T C 4: 129,555,668 S290G possibly damaging Het
Ltbp3 T C 19: 5,748,887 S544P probably benign Het
Lypd6b T A 2: 49,934,819 S4R probably damaging Het
Macf1 T C 4: 123,434,762 D4724G probably null Het
Mcoln2 A G 3: 146,176,610 T255A probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Mki67 C A 7: 135,696,171 R2378L probably benign Het
Mxd1 A G 6: 86,653,155 V27A possibly damaging Het
Myo5a T C 9: 75,171,551 Y864H probably benign Het
Ndel1 A T 11: 68,822,656 N318K possibly damaging Het
Oasl1 A G 5: 114,928,108 Q95R probably benign Het
Olfr1052 T C 2: 86,298,371 L185P probably damaging Het
Olfr1415 A T 1: 92,491,617 I46N probably damaging Het
Olfr198 A T 16: 59,202,183 M81K probably damaging Het
Olfr480 T C 7: 108,066,528 Y60C probably damaging Het
Parp10 T A 15: 76,241,417 Q487L probably damaging Het
Pcdh10 C T 3: 45,379,403 R51C probably damaging Het
Pdpr A T 8: 111,124,475 probably benign Het
Pfpl A T 19: 12,429,696 D437V probably benign Het
Pik3c2a G A 7: 116,388,045 T547I probably benign Het
Pkdrej A C 15: 85,816,762 S1658A possibly damaging Het
Pkn3 T C 2: 30,079,764 probably null Het
Plxdc1 A T 11: 97,932,324 C357S probably damaging Het
Pnp A G 14: 50,950,585 T132A possibly damaging Het
Rcan2 A G 17: 43,836,424 D51G probably damaging Het
Rcn1 T C 2: 105,389,089 N253S probably damaging Het
Rreb1 T A 13: 37,931,884 I1073N probably benign Het
Scaf4 G T 16: 90,245,394 D686E unknown Het
Sfxn5 A C 6: 85,236,925 M221R probably damaging Het
Slc38a1 A G 15: 96,609,860 F104L probably damaging Het
Slc8a1 A T 17: 81,648,118 V497D probably damaging Het
Spryd3 C A 15: 102,118,961 G290C probably damaging Het
Stc2 A T 11: 31,365,418 Y140* probably null Het
Stfa2 A T 16: 36,408,311 I8K possibly damaging Het
Sult3a2 A T 10: 33,782,030 M29K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Triobp G A 15: 79,003,767 R1908Q probably damaging Het
Trpm2 T A 10: 77,966,994 R7* probably null Het
Ttn T C 2: 76,952,157 I912V probably benign Het
Tusc2 T A 9: 107,564,881 V93E probably damaging Het
Uhrf2 T A 19: 30,039,061 probably benign Het
Umodl1 G A 17: 30,959,229 V60M probably damaging Het
Ush2a A T 1: 188,648,304 D2270V probably damaging Het
Vmn2r80 A G 10: 79,169,719 T397A possibly damaging Het
Wbp2 A G 11: 116,086,882 V15A probably benign Het
Zfp182 T A X: 21,030,207 R617W probably damaging Het
Zfp82 C A 7: 30,056,622 R345L probably damaging Het
Zfp85 T C 13: 67,754,965 probably benign Het
Other mutations in Plekhh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Plekhh2 APN 17 84521775 missense probably benign 0.00
IGL00514:Plekhh2 APN 17 84596306 critical splice donor site probably null
IGL00773:Plekhh2 APN 17 84606868 missense probably benign 0.01
IGL00985:Plekhh2 APN 17 84563928 missense probably benign 0.00
IGL01116:Plekhh2 APN 17 84606928 missense possibly damaging 0.94
IGL01394:Plekhh2 APN 17 84557430 missense probably benign 0.24
IGL01419:Plekhh2 APN 17 84583552 splice site probably benign
IGL01932:Plekhh2 APN 17 84577261 missense probably benign 0.00
IGL02097:Plekhh2 APN 17 84599180 missense possibly damaging 0.69
IGL02157:Plekhh2 APN 17 84566942 splice site probably benign
IGL02163:Plekhh2 APN 17 84590795 missense probably benign 0.45
IGL02237:Plekhh2 APN 17 84575785 missense probably benign 0.00
IGL02322:Plekhh2 APN 17 84589466 nonsense probably null
IGL02422:Plekhh2 APN 17 84563809 splice site probably benign
IGL02483:Plekhh2 APN 17 84596260 missense possibly damaging 0.81
IGL02493:Plekhh2 APN 17 84606963 critical splice donor site probably null
IGL03007:Plekhh2 APN 17 84574960 missense possibly damaging 0.65
R0003:Plekhh2 UTSW 17 84557392 missense probably damaging 1.00
R0005:Plekhh2 UTSW 17 84586433 missense probably benign 0.16
R0099:Plekhh2 UTSW 17 84591672 nonsense probably null
R0331:Plekhh2 UTSW 17 84586366 missense possibly damaging 0.81
R0883:Plekhh2 UTSW 17 84618031 missense probably benign 0.11
R1051:Plekhh2 UTSW 17 84521827 critical splice donor site probably null
R1084:Plekhh2 UTSW 17 84571126 missense probably damaging 0.99
R1351:Plekhh2 UTSW 17 84577146 splice site probably benign
R1459:Plekhh2 UTSW 17 84610775 nonsense probably null
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1469:Plekhh2 UTSW 17 84575771 missense probably benign 0.03
R1699:Plekhh2 UTSW 17 84577184 nonsense probably null
R1738:Plekhh2 UTSW 17 84566697 missense possibly damaging 0.67
R1773:Plekhh2 UTSW 17 84599265 missense probably damaging 1.00
R1796:Plekhh2 UTSW 17 84599133 critical splice acceptor site probably null
R1823:Plekhh2 UTSW 17 84575189 missense probably damaging 1.00
R1998:Plekhh2 UTSW 17 84606877 missense possibly damaging 0.58
R2437:Plekhh2 UTSW 17 84586479 splice site probably null
R2847:Plekhh2 UTSW 17 84597966 missense probably damaging 1.00
R4088:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R4227:Plekhh2 UTSW 17 84566795 missense probably benign 0.00
R4249:Plekhh2 UTSW 17 84586337 missense possibly damaging 0.93
R4347:Plekhh2 UTSW 17 84619702 missense probably benign 0.12
R4562:Plekhh2 UTSW 17 84566097 missense probably benign 0.00
R4649:Plekhh2 UTSW 17 84575263 missense probably damaging 1.00
R4737:Plekhh2 UTSW 17 84563959 missense probably benign
R4743:Plekhh2 UTSW 17 84571120 missense probably damaging 1.00
R4858:Plekhh2 UTSW 17 84600697 missense probably damaging 1.00
R5036:Plekhh2 UTSW 17 84571761 missense probably damaging 0.99
R5260:Plekhh2 UTSW 17 84577165 missense probably damaging 0.99
R5385:Plekhh2 UTSW 17 84557466 missense probably benign 0.00
R5409:Plekhh2 UTSW 17 84586478 critical splice donor site probably null
R5510:Plekhh2 UTSW 17 84566847 missense probably benign
R5557:Plekhh2 UTSW 17 84560152 missense probably benign 0.10
R5684:Plekhh2 UTSW 17 84597918 missense probably damaging 1.00
R5685:Plekhh2 UTSW 17 84569882 missense probably damaging 1.00
R5724:Plekhh2 UTSW 17 84566805 missense probably benign 0.00
R5742:Plekhh2 UTSW 17 84597980 missense probably damaging 1.00
R5817:Plekhh2 UTSW 17 84571726 missense possibly damaging 0.86
R6218:Plekhh2 UTSW 17 84591564 missense probably benign 0.03
R6334:Plekhh2 UTSW 17 84566866 missense probably benign
R6345:Plekhh2 UTSW 17 84575787 missense probably benign 0.01
R6617:Plekhh2 UTSW 17 84566287 missense possibly damaging 0.65
R6755:Plekhh2 UTSW 17 84591585 missense probably damaging 1.00
R6864:Plekhh2 UTSW 17 84617999 missense probably benign 0.10
R7171:Plekhh2 UTSW 17 84521788 missense probably damaging 0.96
R7413:Plekhh2 UTSW 17 84566296 missense probably benign 0.03
R7585:Plekhh2 UTSW 17 84577180 missense probably benign 0.11
R7640:Plekhh2 UTSW 17 84610776 missense possibly damaging 0.50
R7733:Plekhh2 UTSW 17 84583524 nonsense probably null
R7877:Plekhh2 UTSW 17 84575006 missense probably benign
R7960:Plekhh2 UTSW 17 84575006 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTTAAAGTGGTTTTGACCTCCATGT -3'
(R):5'- GCCTGTGCTTCTTTGATACCAAACCTA -3'

Sequencing Primer
(F):5'- AGTGGTTTTGACCTCCATGTTTTATG -3'
(R):5'- CTGTTTACAGTCACCATCATGAG -3'
Posted On2014-04-13