Mutagenetix > Incidental Mutation

Incidental Mutation 'R1510:Plekhh2'

167898

Institutional Source

Beutler Lab

Gene Symbol

Plekhh2

Ensembl Gene

ENSMUSG00000040852

Gene Name

pleckstrin homology domain containing, family H (with MyTH4 domain) member 2

Synonyms

MMRRC Submission

039557-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R1510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84511895-84622142 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 84559576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000039628 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047206]

AlphaFold

Q8C115

Predicted Effect

probably null
Transcript: ENSMUST00000047206

SMART Domains

Protein: ENSMUSP00000039628
Gene: ENSMUSG00000040852

Domain	Start	End	E-Value	Type
coiled coil region	19	84	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
coiled coil region	137	174	N/A	INTRINSIC
low complexity region	427	442	N/A	INTRINSIC
low complexity region	579	593	N/A	INTRINSIC
low complexity region	612	651	N/A	INTRINSIC
low complexity region	657	666	N/A	INTRINSIC
PH	703	798	4.7e-19	SMART
PH	811	920	1.15e-4	SMART
MyTH4	954	1109	8.49e-39	SMART
B41	1116	1353	1.01e-27	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.8%

Validation Efficiency

100% (79/79)

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	A	T	12: 55,304,212	Q102L	probably benign	Het
1700001L19Rik	T	A	13: 68,597,477	M1K	probably null	Het
Abcd2	A	G	15: 91,188,978	L326S	probably damaging	Het
Adam18	T	A	8: 24,625,831	T616S	probably benign	Het
Adam22	T	C	5: 8,152,408	K215E	probably benign	Het
Ahi1	T	G	10: 20,959,800	S11A	probably benign	Het
Asb18	T	C	1: 89,996,254	M96V	possibly damaging	Het
Baz2b	T	C	2: 59,922,209	D1149G	probably damaging	Het
C1qtnf3	A	G	15: 10,975,636	E176G	probably benign	Het
Cd151	T	A	7: 141,470,367	S172T	probably benign	Het
Cdh2	G	T	18: 16,648,594	L90I	probably benign	Het
Cdkl3	T	C	11: 52,033,514	V55A	possibly damaging	Het
Chst8	T	A	7: 34,675,268	H382L	probably benign	Het
Cyb5r4	T	C	9: 87,066,643		probably benign	Het
Cyp2j13	T	C	4: 96,061,972	D264G	possibly damaging	Het
Daam1	A	G	12: 71,977,726	M814V	probably damaging	Het
Ddx19b	A	G	8: 111,015,653	I150T	probably damaging	Het
Dync1li1	T	G	9: 114,689,210	S50A	possibly damaging	Het
Fat3	A	T	9: 15,960,055	L3680Q	probably damaging	Het
Fermt1	C	T	2: 132,925,022	E342K	probably benign	Het
Gm21286	T	G	4: 60,838,932		noncoding transcript	Het
Il6	T	C	5: 30,018,062	Y126H	probably damaging	Het
Inhba	G	T	13: 16,027,022	V390L	probably damaging	Het
Ino80	C	T	2: 119,450,049	R278H	probably damaging	Het
Jade3	T	G	X: 20,517,818	N799K	probably benign	Het
Kcnn1	G	A	8: 70,864,070		probably benign	Het
Klhl6	T	C	16: 19,947,098	T585A	probably damaging	Het
Kmt2d	T	A	15: 98,856,377		probably benign	Het
Krt17	C	T	11: 100,257,539	E359K	possibly damaging	Het
Lce1b	T	G	3: 92,655,976	R83S	unknown	Het
Lck	T	C	4: 129,555,668	S290G	possibly damaging	Het
Ltbp3	T	C	19: 5,748,887	S544P	probably benign	Het
Lypd6b	T	A	2: 49,934,819	S4R	probably damaging	Het
Macf1	T	C	4: 123,434,762	D4724G	probably null	Het
Mcoln2	A	G	3: 146,176,610	T255A	probably benign	Het
Mcph1	T	A	8: 18,632,687		probably null	Het
Mki67	C	A	7: 135,696,171	R2378L	probably benign	Het
Mxd1	A	G	6: 86,653,155	V27A	possibly damaging	Het
Myo5a	T	C	9: 75,171,551	Y864H	probably benign	Het
Ndel1	A	T	11: 68,822,656	N318K	possibly damaging	Het
Oasl1	A	G	5: 114,928,108	Q95R	probably benign	Het
Olfr1052	T	C	2: 86,298,371	L185P	probably damaging	Het
Olfr1415	A	T	1: 92,491,617	I46N	probably damaging	Het
Olfr198	A	T	16: 59,202,183	M81K	probably damaging	Het
Olfr480	T	C	7: 108,066,528	Y60C	probably damaging	Het
Parp10	T	A	15: 76,241,417	Q487L	probably damaging	Het
Pcdh10	C	T	3: 45,379,403	R51C	probably damaging	Het
Pdpr	A	T	8: 111,124,475		probably benign	Het
Pfpl	A	T	19: 12,429,696	D437V	probably benign	Het
Pik3c2a	G	A	7: 116,388,045	T547I	probably benign	Het
Pkdrej	A	C	15: 85,816,762	S1658A	possibly damaging	Het
Pkn3	T	C	2: 30,079,764		probably null	Het
Plxdc1	A	T	11: 97,932,324	C357S	probably damaging	Het
Pnp	A	G	14: 50,950,585	T132A	possibly damaging	Het
Rcan2	A	G	17: 43,836,424	D51G	probably damaging	Het
Rcn1	T	C	2: 105,389,089	N253S	probably damaging	Het
Rreb1	T	A	13: 37,931,884	I1073N	probably benign	Het
Scaf4	G	T	16: 90,245,394	D686E	unknown	Het
Sfxn5	A	C	6: 85,236,925	M221R	probably damaging	Het
Slc38a1	A	G	15: 96,609,860	F104L	probably damaging	Het
Slc8a1	A	T	17: 81,648,118	V497D	probably damaging	Het
Spryd3	C	A	15: 102,118,961	G290C	probably damaging	Het
Stc2	A	T	11: 31,365,418	Y140*	probably null	Het
Stfa2	A	T	16: 36,408,311	I8K	possibly damaging	Het
Sult3a2	A	T	10: 33,782,030	M29K	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Triobp	G	A	15: 79,003,767	R1908Q	probably damaging	Het
Trpm2	T	A	10: 77,966,994	R7*	probably null	Het
Ttn	T	C	2: 76,952,157	I912V	probably benign	Het
Tusc2	T	A	9: 107,564,881	V93E	probably damaging	Het
Uhrf2	T	A	19: 30,039,061		probably benign	Het
Umodl1	G	A	17: 30,959,229	V60M	probably damaging	Het
Ush2a	A	T	1: 188,648,304	D2270V	probably damaging	Het
Vmn2r80	A	G	10: 79,169,719	T397A	possibly damaging	Het
Wbp2	A	G	11: 116,086,882	V15A	probably benign	Het
Zfp182	T	A	X: 21,030,207	R617W	probably damaging	Het
Zfp82	C	A	7: 30,056,622	R345L	probably damaging	Het
Zfp85	T	C	13: 67,754,965		probably benign	Het

Other mutations in Plekhh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Plekhh2	APN	17	84521775	missense	probably benign	0.00
IGL00514:Plekhh2	APN	17	84596306	critical splice donor site	probably null
IGL00773:Plekhh2	APN	17	84606868	missense	probably benign	0.01
IGL00985:Plekhh2	APN	17	84563928	missense	probably benign	0.00
IGL01116:Plekhh2	APN	17	84606928	missense	possibly damaging	0.94
IGL01394:Plekhh2	APN	17	84557430	missense	probably benign	0.24
IGL01419:Plekhh2	APN	17	84583552	splice site	probably benign
IGL01932:Plekhh2	APN	17	84577261	missense	probably benign	0.00
IGL02097:Plekhh2	APN	17	84599180	missense	possibly damaging	0.69
IGL02157:Plekhh2	APN	17	84566942	splice site	probably benign
IGL02163:Plekhh2	APN	17	84590795	missense	probably benign	0.45
IGL02237:Plekhh2	APN	17	84575785	missense	probably benign	0.00
IGL02322:Plekhh2	APN	17	84589466	nonsense	probably null
IGL02422:Plekhh2	APN	17	84563809	splice site	probably benign
IGL02483:Plekhh2	APN	17	84596260	missense	possibly damaging	0.81
IGL02493:Plekhh2	APN	17	84606963	critical splice donor site	probably null
IGL03007:Plekhh2	APN	17	84574960	missense	possibly damaging	0.65
R0003:Plekhh2	UTSW	17	84557392	missense	probably damaging	1.00
R0005:Plekhh2	UTSW	17	84586433	missense	probably benign	0.16
R0099:Plekhh2	UTSW	17	84591672	nonsense	probably null
R0331:Plekhh2	UTSW	17	84586366	missense	possibly damaging	0.81
R0883:Plekhh2	UTSW	17	84618031	missense	probably benign	0.11
R1051:Plekhh2	UTSW	17	84521827	critical splice donor site	probably null
R1084:Plekhh2	UTSW	17	84571126	missense	probably damaging	0.99
R1351:Plekhh2	UTSW	17	84577146	splice site	probably benign
R1459:Plekhh2	UTSW	17	84610775	nonsense	probably null
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1469:Plekhh2	UTSW	17	84575771	missense	probably benign	0.03
R1699:Plekhh2	UTSW	17	84577184	nonsense	probably null
R1738:Plekhh2	UTSW	17	84566697	missense	possibly damaging	0.67
R1773:Plekhh2	UTSW	17	84599265	missense	probably damaging	1.00
R1796:Plekhh2	UTSW	17	84599133	critical splice acceptor site	probably null
R1823:Plekhh2	UTSW	17	84575189	missense	probably damaging	1.00
R1998:Plekhh2	UTSW	17	84606877	missense	possibly damaging	0.58
R2437:Plekhh2	UTSW	17	84586479	splice site	probably null
R2847:Plekhh2	UTSW	17	84597966	missense	probably damaging	1.00
R4088:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R4227:Plekhh2	UTSW	17	84566795	missense	probably benign	0.00
R4249:Plekhh2	UTSW	17	84586337	missense	possibly damaging	0.93
R4347:Plekhh2	UTSW	17	84619702	missense	probably benign	0.12
R4562:Plekhh2	UTSW	17	84566097	missense	probably benign	0.00
R4649:Plekhh2	UTSW	17	84575263	missense	probably damaging	1.00
R4737:Plekhh2	UTSW	17	84563959	missense	probably benign
R4743:Plekhh2	UTSW	17	84571120	missense	probably damaging	1.00
R4858:Plekhh2	UTSW	17	84600697	missense	probably damaging	1.00
R5036:Plekhh2	UTSW	17	84571761	missense	probably damaging	0.99
R5260:Plekhh2	UTSW	17	84577165	missense	probably damaging	0.99
R5385:Plekhh2	UTSW	17	84557466	missense	probably benign	0.00
R5409:Plekhh2	UTSW	17	84586478	critical splice donor site	probably null
R5510:Plekhh2	UTSW	17	84566847	missense	probably benign
R5557:Plekhh2	UTSW	17	84560152	missense	probably benign	0.10
R5684:Plekhh2	UTSW	17	84597918	missense	probably damaging	1.00
R5685:Plekhh2	UTSW	17	84569882	missense	probably damaging	1.00
R5724:Plekhh2	UTSW	17	84566805	missense	probably benign	0.00
R5742:Plekhh2	UTSW	17	84597980	missense	probably damaging	1.00
R5817:Plekhh2	UTSW	17	84571726	missense	possibly damaging	0.86
R6218:Plekhh2	UTSW	17	84591564	missense	probably benign	0.03
R6334:Plekhh2	UTSW	17	84566866	missense	probably benign
R6345:Plekhh2	UTSW	17	84575787	missense	probably benign	0.01
R6617:Plekhh2	UTSW	17	84566287	missense	possibly damaging	0.65
R6755:Plekhh2	UTSW	17	84591585	missense	probably damaging	1.00
R6864:Plekhh2	UTSW	17	84617999	missense	probably benign	0.10
R7171:Plekhh2	UTSW	17	84521788	missense	probably damaging	0.96
R7413:Plekhh2	UTSW	17	84566296	missense	probably benign	0.03
R7585:Plekhh2	UTSW	17	84577180	missense	probably benign	0.11
R7640:Plekhh2	UTSW	17	84610776	missense	possibly damaging	0.50
R7733:Plekhh2	UTSW	17	84583524	nonsense	probably null
R7877:Plekhh2	UTSW	17	84575006	missense	probably benign
R8085:Plekhh2	UTSW	17	84597956	missense	probably damaging	0.98
R8206:Plekhh2	UTSW	17	84590849	missense	possibly damaging	0.47
R8296:Plekhh2	UTSW	17	84600685	missense	probably damaging	0.98
R8344:Plekhh2	UTSW	17	84571761	missense	possibly damaging	0.64
R8438:Plekhh2	UTSW	17	84569951	missense	probably benign
R8487:Plekhh2	UTSW	17	84557481	missense	possibly damaging	0.55
R8708:Plekhh2	UTSW	17	84574993	missense	probably benign	0.00
R8830:Plekhh2	UTSW	17	84521803	missense	probably damaging	1.00
R8847:Plekhh2	UTSW	17	84571051	missense	probably benign	0.00
R8918:Plekhh2	UTSW	17	84599193	missense	possibly damaging	0.80
R9047:Plekhh2	UTSW	17	84590762	missense	probably damaging	0.99
R9404:Plekhh2	UTSW	17	84571040	critical splice acceptor site	probably null
R9428:Plekhh2	UTSW	17	84566413	missense	probably benign
R9516:Plekhh2	UTSW	17	84610812	missense	probably benign	0.00
R9559:Plekhh2	UTSW	17	84591589	missense	probably damaging	1.00
R9589:Plekhh2	UTSW	17	84547490	missense	possibly damaging	0.90
R9641:Plekhh2	UTSW	17	84566702	missense	probably damaging	1.00
R9659:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95
R9788:Plekhh2	UTSW	17	84547464	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGGTTTAAAGTGGTTTTGACCTCCATGT -3'
(R):5'- GCCTGTGCTTCTTTGATACCAAACCTA -3'

Sequencing Primer
(F):5'- AGTGGTTTTGACCTCCATGTTTTATG -3'
(R):5'- CTGTTTACAGTCACCATCATGAG -3'

Posted On

2014-04-13