Incidental Mutation 'R1506:Casp8'
ID167905
Institutional Source Beutler Lab
Gene Symbol Casp8
Ensembl Gene ENSMUSG00000026029
Gene Namecaspase 8
SynonymsMACH, Mch5, FLICE, Caspase-8
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58795374-58847503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58824196 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 105 (E105G)
Ref Sequence ENSEMBL: ENSMUSP00000140546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027189] [ENSMUST00000165549] [ENSMUST00000190213] [ENSMUST00000191201]
Predicted Effect probably damaging
Transcript: ENSMUST00000027189
AA Change: E85G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029
AA Change: E85G

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165549
AA Change: E85G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029
AA Change: E85G

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190213
AA Change: E105G

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029
AA Change: E105G

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191201
AA Change: E105G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029
AA Change: E105G

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Meta Mutation Damage Score 0.7171 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Casp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Casp8 APN 1 58827314 critical splice donor site probably null
IGL00825:Casp8 APN 1 58829006 missense probably benign 0.02
IGL02025:Casp8 APN 1 58824147 missense possibly damaging 0.81
IGL02549:Casp8 APN 1 58833766 missense probably benign
amontillado UTSW 1 58844770 missense probably damaging 1.00
Porto UTSW 1 58833698 missense possibly damaging 0.89
IGL02991:Casp8 UTSW 1 58827279 missense probably benign 0.00
R0609:Casp8 UTSW 1 58844792 missense probably benign 0.00
R0960:Casp8 UTSW 1 58829013 critical splice donor site probably null
R1433:Casp8 UTSW 1 58824124 missense probably damaging 1.00
R1505:Casp8 UTSW 1 58828922 missense probably damaging 0.99
R1596:Casp8 UTSW 1 58831674 splice site probably benign
R1674:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1676:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1981:Casp8 UTSW 1 58828962 synonymous probably null
R3909:Casp8 UTSW 1 58844811 missense probably damaging 1.00
R3911:Casp8 UTSW 1 58833705 missense probably damaging 1.00
R4231:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4233:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4234:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4235:Casp8 UTSW 1 58833698 missense possibly damaging 0.89
R4236:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4917:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R4918:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R5063:Casp8 UTSW 1 58844374 missense probably damaging 1.00
R5092:Casp8 UTSW 1 58844676 missense possibly damaging 0.53
R5153:Casp8 UTSW 1 58844845 missense probably benign 0.00
R5964:Casp8 UTSW 1 58833736 missense possibly damaging 0.62
R5979:Casp8 UTSW 1 58828912 missense probably benign
R7602:Casp8 UTSW 1 58833739 missense probably benign 0.43
R7675:Casp8 UTSW 1 58823947 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTGTTGACCCAGGTTACAGCTCTTC -3'
(R):5'- TTTAGCCCGCAGTCTCACAAGTC -3'

Sequencing Primer
(F):5'- GCTATTGCTGAAGAACTGGGC -3'
(R):5'- TCACTTCACACATGTCACAGGG -3'
Posted On2014-04-13