Incidental Mutation 'R1506:Ino80'
ID167912
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 119425265 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 913 (L913*)
Ref Sequence ENSEMBL: ENSMUSP00000106431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably null
Transcript: ENSMUST00000049920
AA Change: L913*
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: L913*

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110808
AA Change: L913*
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: L913*

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGAGCAAGCAGGGTTGACTG -3'
(R):5'- TCATCGGAATTGGGTGTTGGAAACAG -3'

Sequencing Primer
(F):5'- ttccaacacccaattcccc -3'
(R):5'- CAGGTTGTGCTACATGAAACTTCC -3'
Posted On2014-04-13