Incidental Mutation 'R1506:Prex1'
ID 167914
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Name phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
Synonyms P-REX1
MMRRC Submission 039554-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.188) question?
Stock # R1506 (G1)
Quality Score 189
Status Validated
Chromosome 2
Chromosomal Location 166408265-166555752 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 166429001 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 694 (V694E)
Ref Sequence ENSEMBL: ENSMUSP00000096679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
AlphaFold Q69ZK0
Predicted Effect probably damaging
Transcript: ENSMUST00000036719
AA Change: V864E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: V864E

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099080
AA Change: V694E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621
AA Change: V694E

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Meta Mutation Damage Score 0.6648 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,248,144 (GRCm39) T1152K possibly damaging Het
Acp3 T A 9: 104,201,373 (GRCm39) T82S probably damaging Het
Adam23 C T 1: 63,586,973 (GRCm39) P445S probably benign Het
Ap3b1 T A 13: 94,582,651 (GRCm39) probably benign Het
Artn A G 4: 117,784,058 (GRCm39) V136A probably damaging Het
Ash1l A G 3: 88,965,806 (GRCm39) T2403A probably damaging Het
Bbof1 G T 12: 84,470,273 (GRCm39) V120L probably damaging Het
Boc A G 16: 44,323,928 (GRCm39) Y158H probably damaging Het
Casp8 A G 1: 58,863,355 (GRCm39) E105G probably damaging Het
Cers4 T C 8: 4,570,557 (GRCm39) F206L probably benign Het
Chrna9 A G 5: 66,126,479 (GRCm39) T78A probably benign Het
Creb3 A T 4: 43,566,193 (GRCm39) T263S possibly damaging Het
Cyp2c40 A G 19: 39,766,443 (GRCm39) V384A probably damaging Het
Dip2b G A 15: 100,080,994 (GRCm39) V879M probably damaging Het
Dnah17 C A 11: 118,016,213 (GRCm39) V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 (GRCm39) K144N probably damaging Het
Ercc6 A T 14: 32,291,821 (GRCm39) I1062F probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fat2 C A 11: 55,175,090 (GRCm39) E1874D probably benign Het
Fbxw21 T A 9: 108,977,257 (GRCm39) I151F probably damaging Het
Fhip2a A G 19: 57,357,007 (GRCm39) I33V probably benign Het
Foxn1 A G 11: 78,256,761 (GRCm39) probably benign Het
Gpr63 G A 4: 25,008,227 (GRCm39) R317H probably damaging Het
Grip1 C A 10: 119,814,356 (GRCm39) H296N probably damaging Het
Gtdc1 A T 2: 44,465,506 (GRCm39) M288K possibly damaging Het
Guf1 T A 5: 69,724,509 (GRCm39) D488E possibly damaging Het
Gvin3 C T 7: 106,200,788 (GRCm39) D819N probably benign Het
Heatr5b C A 17: 79,060,576 (GRCm39) R2033L probably damaging Het
Hsd17b2 T A 8: 118,429,004 (GRCm39) probably null Het
Ino80 A T 2: 119,255,746 (GRCm39) L913* probably null Het
Inppl1 A C 7: 101,473,174 (GRCm39) S1159A probably benign Het
Kcnk7 G A 19: 5,756,140 (GRCm39) C122Y probably damaging Het
Mtor A G 4: 148,620,962 (GRCm39) probably benign Het
Muc4 A T 16: 32,574,033 (GRCm39) S704C possibly damaging Het
Nckap5 A T 1: 125,953,650 (GRCm39) C967* probably null Het
Nek10 T C 14: 14,999,078 (GRCm38) probably benign Het
Oas1h A T 5: 121,009,951 (GRCm39) D342V possibly damaging Het
Or10j2 A G 1: 173,098,336 (GRCm39) N198S probably benign Het
Or2ak7 T A 11: 58,575,014 (GRCm39) L105Q probably benign Het
Or2n1 A T 17: 38,486,091 (GRCm39) M39L probably benign Het
Or4m1 A G 14: 50,557,941 (GRCm39) V117A probably benign Het
Or8b1b T C 9: 38,375,439 (GRCm39) M34T probably benign Het
Rad50 G A 11: 53,570,312 (GRCm39) A810V probably damaging Het
Rcor1 T C 12: 111,076,271 (GRCm39) S410P probably damaging Het
Rps14 A T 18: 60,909,551 (GRCm39) N26I probably benign Het
Slc38a1 T C 15: 96,483,431 (GRCm39) D299G probably benign Het
Slc5a1 T A 5: 33,312,052 (GRCm39) N481K possibly damaging Het
Slco3a1 A T 7: 74,009,683 (GRCm39) probably null Het
Spart T C 3: 55,024,992 (GRCm39) S196P probably damaging Het
Speg A G 1: 75,394,307 (GRCm39) T1701A probably benign Het
Sugt1 A G 14: 79,862,365 (GRCm39) N271S probably benign Het
Tbx15 A T 3: 99,259,228 (GRCm39) L366F possibly damaging Het
Tnc G A 4: 63,925,921 (GRCm39) T953I possibly damaging Het
Uqcc1 A G 2: 155,753,738 (GRCm39) S46P probably damaging Het
Vmn2r18 T C 5: 151,499,099 (GRCm39) probably null Het
Vmn2r7 T A 3: 64,614,500 (GRCm39) Y438F probably benign Het
Vmn2r72 T A 7: 85,398,419 (GRCm39) K520N probably benign Het
Vps52 T C 17: 34,176,868 (GRCm39) L74P probably damaging Het
Xpo5 G T 17: 46,538,814 (GRCm39) M673I probably benign Het
Zscan18 A G 7: 12,508,129 (GRCm39) V457A probably damaging Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166,480,321 (GRCm39) missense probably damaging 1.00
IGL00309:Prex1 APN 2 166,451,743 (GRCm39) missense probably damaging 0.99
IGL00953:Prex1 APN 2 166,480,329 (GRCm39) missense probably damaging 1.00
IGL00961:Prex1 APN 2 166,427,656 (GRCm39) missense probably damaging 0.98
IGL01300:Prex1 APN 2 166,480,327 (GRCm39) missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166,411,260 (GRCm39) splice site probably benign
IGL01753:Prex1 APN 2 166,444,802 (GRCm39) missense probably benign 0.11
IGL01819:Prex1 APN 2 166,463,165 (GRCm39) missense probably damaging 1.00
IGL02058:Prex1 APN 2 166,427,103 (GRCm39) missense probably benign 0.00
IGL02251:Prex1 APN 2 166,419,806 (GRCm39) missense probably damaging 0.99
IGL02326:Prex1 APN 2 166,463,105 (GRCm39) missense probably benign 0.35
IGL02366:Prex1 APN 2 166,422,347 (GRCm39) missense probably damaging 1.00
IGL02414:Prex1 APN 2 166,451,748 (GRCm39) missense probably damaging 1.00
IGL02660:Prex1 APN 2 166,435,787 (GRCm39) missense probably damaging 0.97
IGL02666:Prex1 APN 2 166,414,909 (GRCm39) missense probably benign 0.00
IGL02874:Prex1 APN 2 166,426,967 (GRCm39) missense probably damaging 1.00
IGL02935:Prex1 APN 2 166,412,265 (GRCm39) missense probably damaging 1.00
IGL03179:Prex1 APN 2 166,427,114 (GRCm39) missense probably benign 0.31
R0207:Prex1 UTSW 2 166,427,818 (GRCm39) missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166,428,619 (GRCm39) unclassified probably benign
R0420:Prex1 UTSW 2 166,431,491 (GRCm39) missense probably benign 0.13
R0449:Prex1 UTSW 2 166,411,297 (GRCm39) missense probably benign 0.16
R0458:Prex1 UTSW 2 166,427,743 (GRCm39) missense probably damaging 0.99
R0927:Prex1 UTSW 2 166,428,457 (GRCm39) missense probably benign 0.01
R1299:Prex1 UTSW 2 166,427,827 (GRCm39) missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166,435,781 (GRCm39) missense probably damaging 1.00
R1440:Prex1 UTSW 2 166,422,383 (GRCm39) missense probably damaging 0.98
R1725:Prex1 UTSW 2 166,443,656 (GRCm39) missense probably damaging 1.00
R1831:Prex1 UTSW 2 166,427,021 (GRCm39) missense probably damaging 1.00
R1883:Prex1 UTSW 2 166,425,192 (GRCm39) missense probably benign 0.20
R1896:Prex1 UTSW 2 166,428,574 (GRCm39) missense probably benign 0.01
R2022:Prex1 UTSW 2 166,417,534 (GRCm39) missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166,411,285 (GRCm39) missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166,429,077 (GRCm39) missense probably benign 0.00
R2263:Prex1 UTSW 2 166,430,988 (GRCm39) splice site probably benign
R2276:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2279:Prex1 UTSW 2 166,419,875 (GRCm39) missense probably benign 0.34
R2680:Prex1 UTSW 2 166,443,692 (GRCm39) missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166,430,956 (GRCm39) missense probably benign 0.04
R3421:Prex1 UTSW 2 166,459,774 (GRCm39) missense probably damaging 1.00
R3614:Prex1 UTSW 2 166,451,701 (GRCm39) missense probably damaging 1.00
R4244:Prex1 UTSW 2 166,412,256 (GRCm39) missense probably damaging 1.00
R4605:Prex1 UTSW 2 166,555,464 (GRCm39) missense probably benign 0.45
R4685:Prex1 UTSW 2 166,480,252 (GRCm39) missense probably damaging 0.97
R4787:Prex1 UTSW 2 166,480,260 (GRCm39) missense probably benign 0.01
R4796:Prex1 UTSW 2 166,434,211 (GRCm39) missense probably damaging 1.00
R4825:Prex1 UTSW 2 166,427,777 (GRCm39) nonsense probably null
R4955:Prex1 UTSW 2 166,415,143 (GRCm39) missense probably damaging 0.99
R5046:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R5095:Prex1 UTSW 2 166,423,841 (GRCm39) missense probably damaging 1.00
R5408:Prex1 UTSW 2 166,417,573 (GRCm39) small insertion probably benign
R5462:Prex1 UTSW 2 166,486,728 (GRCm39) missense probably benign 0.02
R5535:Prex1 UTSW 2 166,422,193 (GRCm39) missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166,428,579 (GRCm39) missense probably damaging 1.00
R5813:Prex1 UTSW 2 166,425,127 (GRCm39) missense probably benign
R5860:Prex1 UTSW 2 166,486,604 (GRCm39) intron probably benign
R5984:Prex1 UTSW 2 166,427,664 (GRCm39) missense probably damaging 1.00
R6009:Prex1 UTSW 2 166,423,904 (GRCm39) missense probably damaging 1.00
R6174:Prex1 UTSW 2 166,414,883 (GRCm39) missense probably benign 0.00
R6345:Prex1 UTSW 2 166,414,880 (GRCm39) missense probably null 0.81
R6897:Prex1 UTSW 2 166,423,913 (GRCm39) missense probably damaging 0.99
R6935:Prex1 UTSW 2 166,441,575 (GRCm39) missense probably damaging 1.00
R7025:Prex1 UTSW 2 166,455,107 (GRCm39) small insertion probably benign
R7037:Prex1 UTSW 2 166,429,100 (GRCm39) missense probably benign 0.05
R7076:Prex1 UTSW 2 166,475,302 (GRCm39) missense probably damaging 0.99
R7181:Prex1 UTSW 2 166,412,291 (GRCm39) missense probably damaging 1.00
R7361:Prex1 UTSW 2 166,555,490 (GRCm39) missense probably benign 0.04
R7381:Prex1 UTSW 2 166,429,047 (GRCm39) missense probably damaging 1.00
R7721:Prex1 UTSW 2 166,419,810 (GRCm39) nonsense probably null
R7763:Prex1 UTSW 2 166,555,629 (GRCm39) missense unknown
R7809:Prex1 UTSW 2 166,415,164 (GRCm39) missense possibly damaging 0.91
R7915:Prex1 UTSW 2 166,463,112 (GRCm39) missense probably damaging 1.00
R7971:Prex1 UTSW 2 166,423,859 (GRCm39) missense probably damaging 1.00
R7998:Prex1 UTSW 2 166,428,965 (GRCm39) critical splice donor site probably null
R8029:Prex1 UTSW 2 166,417,523 (GRCm39) missense probably benign 0.01
R8193:Prex1 UTSW 2 166,435,780 (GRCm39) missense possibly damaging 0.60
R8352:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8452:Prex1 UTSW 2 166,431,493 (GRCm39) missense probably benign 0.05
R8927:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R8928:Prex1 UTSW 2 166,426,995 (GRCm39) missense probably damaging 0.97
R9021:Prex1 UTSW 2 166,432,429 (GRCm39) missense possibly damaging 0.47
R9070:Prex1 UTSW 2 166,427,707 (GRCm39) missense probably damaging 1.00
R9213:Prex1 UTSW 2 166,417,669 (GRCm39) missense probably damaging 0.99
R9511:Prex1 UTSW 2 166,413,481 (GRCm39) missense probably damaging 1.00
R9514:Prex1 UTSW 2 166,419,896 (GRCm39) missense possibly damaging 0.53
R9529:Prex1 UTSW 2 166,431,518 (GRCm39) missense probably damaging 1.00
X0065:Prex1 UTSW 2 166,428,545 (GRCm39) missense probably benign
Z1176:Prex1 UTSW 2 166,414,890 (GRCm39) nonsense probably null
Z1177:Prex1 UTSW 2 166,434,148 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGAATCAGCAACCCCTGACCTTG -3'
(R):5'- TGGTGGCTCTGGCAACTTTGAAC -3'

Sequencing Primer
(F):5'- CTTGAGGCAGAACAGACCAG -3'
(R):5'- CAGACTGGCAGTGTCCTGATG -3'
Posted On 2014-04-13