Mutagenetix > Incidental Mutation

Incidental Mutation 'R1506:Tbx15'

167918

Institutional Source

Beutler Lab

Gene Symbol

Tbx15

Ensembl Gene

ENSMUSG00000027868

Gene Name

T-box 15

Synonyms

de, Tbx14, Tbx8

MMRRC Submission

039554-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R1506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99240381-99354259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 99351912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 366 (L366F)

Ref Sequence

ENSEMBL: ENSMUSP00000029462 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029462]

AlphaFold

O70306

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029462
AA Change: L366F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: L366F

Domain	Start	End	E-Value	Type
low complexity region	2	17	N/A	INTRINSIC
TBOX	112	309	8.05e-131	SMART
Blast:TBOX	310	482	8e-83	BLAST
low complexity region	486	492	N/A	INTRINSIC

Meta Mutation Damage Score

0.0868

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	G	T	11: 94,357,318	T1152K	possibly damaging	Het
Acpp	T	A	9: 104,324,174	T82S	probably damaging	Het
Adam23	C	T	1: 63,547,814	P445S	probably benign	Het
Ap3b1	T	A	13: 94,446,143		probably benign	Het
Artn	A	G	4: 117,926,861	V136A	probably damaging	Het
Ash1l	A	G	3: 89,058,499	T2403A	probably damaging	Het
Bbof1	G	T	12: 84,423,499	V120L	probably damaging	Het
Boc	A	G	16: 44,503,565	Y158H	probably damaging	Het
Casp8	A	G	1: 58,824,196	E105G	probably damaging	Het
Cers4	T	C	8: 4,520,557	F206L	probably benign	Het
Chrna9	A	G	5: 65,969,136	T78A	probably benign	Het
Creb3	A	T	4: 43,566,193	T263S	possibly damaging	Het
Cyp2c40	A	G	19: 39,777,999	V384A	probably damaging	Het
Dip2b	G	A	15: 100,183,113	V879M	probably damaging	Het
Dnah17	C	A	11: 118,125,387	V14F	possibly damaging	Het
Epb41l4b	T	A	4: 57,088,824	K144N	probably damaging	Het
Ercc6	A	T	14: 32,569,864	I1062F	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam160b1	A	G	19: 57,368,575	I33V	probably benign	Het
Fat2	C	A	11: 55,284,264	E1874D	probably benign	Het
Fbxw21	T	A	9: 109,148,189	I151F	probably damaging	Het
Foxn1	A	G	11: 78,365,935		probably benign	Het
Gm1966	C	T	7: 106,601,581	D819N	probably benign	Het
Gpr63	G	A	4: 25,008,227	R317H	probably damaging	Het
Grip1	C	A	10: 119,978,451	H296N	probably damaging	Het
Gtdc1	A	T	2: 44,575,494	M288K	possibly damaging	Het
Guf1	T	A	5: 69,567,166	D488E	possibly damaging	Het
Heatr5b	C	A	17: 78,753,147	R2033L	probably damaging	Het
Hsd17b2	T	A	8: 117,702,265		probably null	Het
Ino80	A	T	2: 119,425,265	L913*	probably null	Het
Inppl1	A	C	7: 101,823,967	S1159A	probably benign	Het
Kcnk7	G	A	19: 5,706,112	C122Y	probably damaging	Het
Mtor	A	G	4: 148,536,505		probably benign	Het
Muc4	A	T	16: 32,752,233	S704C	possibly damaging	Het
Nckap5	A	T	1: 126,025,913	C967*	probably null	Het
Nek10	T	C	14: 14,999,078		probably benign	Het
Oas1h	A	T	5: 120,871,888	D342V	possibly damaging	Het
Olfr134	A	T	17: 38,175,200	M39L	probably benign	Het
Olfr320	T	A	11: 58,684,188	L105Q	probably benign	Het
Olfr418	A	G	1: 173,270,769	N198S	probably benign	Het
Olfr734	A	G	14: 50,320,484	V117A	probably benign	Het
Olfr904	T	C	9: 38,464,143	M34T	probably benign	Het
Prex1	A	T	2: 166,587,081	V694E	probably damaging	Het
Rad50	G	A	11: 53,679,485	A810V	probably damaging	Het
Rcor1	T	C	12: 111,109,837	S410P	probably damaging	Het
Rps14	A	T	18: 60,776,479	N26I	probably benign	Het
Slc38a1	T	C	15: 96,585,550	D299G	probably benign	Het
Slc5a1	T	A	5: 33,154,708	N481K	possibly damaging	Het
Slco3a1	A	T	7: 74,359,935		probably null	Het
Speg	A	G	1: 75,417,663	T1701A	probably benign	Het
Spg20	T	C	3: 55,117,571	S196P	probably damaging	Het
Sugt1	A	G	14: 79,624,925	N271S	probably benign	Het
Tnc	G	A	4: 64,007,684	T953I	possibly damaging	Het
Uqcc1	A	G	2: 155,911,818	S46P	probably damaging	Het
Vmn2r18	T	C	5: 151,575,634		probably null	Het
Vmn2r7	T	A	3: 64,707,079	Y438F	probably benign	Het
Vmn2r72	T	A	7: 85,749,211	K520N	probably benign	Het
Vps52	T	C	17: 33,957,894	L74P	probably damaging	Het
Xpo5	G	T	17: 46,227,888	M673I	probably benign	Het
Zscan18	A	G	7: 12,774,202	V457A	probably damaging	Het

Other mutations in Tbx15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Tbx15	APN	3	99316246	missense	probably damaging	1.00
IGL01458:Tbx15	APN	3	99316228	missense	probably damaging	0.98
IGL01633:Tbx15	APN	3	99313042	missense	probably damaging	0.97
IGL02338:Tbx15	APN	3	99352484	missense	probably damaging	1.00
IGL02415:Tbx15	APN	3	99352510	missense	probably benign	0.01
IGL03143:Tbx15	APN	3	99352198	missense	possibly damaging	0.67
IGL03201:Tbx15	APN	3	99351980	missense	probably benign	0.00
shin_guard	UTSW	3	99352192	missense	possibly damaging	0.90
Shortcut	UTSW	3	99313073	nonsense	probably null
R0012:Tbx15	UTSW	3	99352096	missense	probably benign
R0109:Tbx15	UTSW	3	99351866	missense	possibly damaging	0.92
R0277:Tbx15	UTSW	3	99352391	missense	probably damaging	1.00
R0462:Tbx15	UTSW	3	99316318	missense	probably damaging	1.00
R1134:Tbx15	UTSW	3	99316323	missense	probably damaging	0.98
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1347:Tbx15	UTSW	3	99352111	missense	possibly damaging	0.92
R1681:Tbx15	UTSW	3	99351824	splice site	probably null
R1762:Tbx15	UTSW	3	99351944	nonsense	probably null
R1789:Tbx15	UTSW	3	99352246	nonsense	probably null
R2167:Tbx15	UTSW	3	99326455	splice site	probably benign
R2254:Tbx15	UTSW	3	99351874	missense	possibly damaging	0.52
R2357:Tbx15	UTSW	3	99316356	splice site	probably null
R2441:Tbx15	UTSW	3	99352511	missense	probably damaging	0.99
R3010:Tbx15	UTSW	3	99253893	intron	probably benign
R3118:Tbx15	UTSW	3	99352154	missense	probably damaging	0.96
R4081:Tbx15	UTSW	3	99313054	missense	possibly damaging	0.92
R4610:Tbx15	UTSW	3	99352367	missense	probably damaging	1.00
R4898:Tbx15	UTSW	3	99352267	missense	possibly damaging	0.95
R4950:Tbx15	UTSW	3	99326384	missense	possibly damaging	0.82
R4982:Tbx15	UTSW	3	99254074	missense	probably benign	0.06
R4999:Tbx15	UTSW	3	99316333	missense	probably damaging	1.00
R5236:Tbx15	UTSW	3	99352046	missense	possibly damaging	0.92
R5339:Tbx15	UTSW	3	99316284	missense	possibly damaging	0.61
R5364:Tbx15	UTSW	3	99352192	missense	possibly damaging	0.90
R5493:Tbx15	UTSW	3	99352564	missense	probably benign
R5690:Tbx15	UTSW	3	99308850	missense	probably damaging	0.99
R5756:Tbx15	UTSW	3	99313086	missense	probably damaging	1.00
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6032:Tbx15	UTSW	3	99352517	missense	probably benign	0.28
R6156:Tbx15	UTSW	3	99313115	critical splice donor site	probably null
R6173:Tbx15	UTSW	3	99253887	nonsense	probably null
R6596:Tbx15	UTSW	3	99352192	missense	probably benign
R6680:Tbx15	UTSW	3	99313073	nonsense	probably null
R6931:Tbx15	UTSW	3	99352151	missense	probably damaging	1.00
R8129:Tbx15	UTSW	3	99253938	missense	probably damaging	1.00
R8155:Tbx15	UTSW	3	99352570	missense	possibly damaging	0.69
R8230:Tbx15	UTSW	3	99351989	missense	probably damaging	1.00
R8729:Tbx15	UTSW	3	99313060	missense	possibly damaging	0.90
R8929:Tbx15	UTSW	3	99314903	missense	probably damaging	1.00
R9038:Tbx15	UTSW	3	99314769	missense	probably benign	0.14
R9688:Tbx15	UTSW	3	99326392	missense	possibly damaging	0.89
R9746:Tbx15	UTSW	3	99352331	missense	probably damaging	1.00
X0023:Tbx15	UTSW	3	99314835	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAATGTGTGCTCAAACATGTGAC -3'
(R):5'- GCCTGCCTGCATGACATACTGAAAC -3'

Sequencing Primer
(F):5'- GTGCTCAAACATGTGACATCATC -3'
(R):5'- TATTCCTGAGATCAGAGATGGAGTCC -3'

Posted On

2014-04-13