Incidental Mutation 'R1506:Tbx15'
ID167918
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene NameT-box 15
Synonymsde, Tbx14, Tbx8
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location99240381-99354259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99351912 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 366 (L366F)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: L366F

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: L366F

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99316246 missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99316228 missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99313042 missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99352484 missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99352510 missense probably benign 0.01
IGL03143:Tbx15 APN 3 99352198 missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99351980 missense probably benign 0.00
shin_guard UTSW 3 99352192 missense possibly damaging 0.90
R0012:Tbx15 UTSW 3 99352096 missense probably benign
R0109:Tbx15 UTSW 3 99351866 missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99352391 missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99316318 missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99316323 missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99352111 missense possibly damaging 0.92
R1681:Tbx15 UTSW 3 99351824 splice site probably null
R1762:Tbx15 UTSW 3 99351944 nonsense probably null
R1789:Tbx15 UTSW 3 99352246 nonsense probably null
R2167:Tbx15 UTSW 3 99326455 splice site probably benign
R2254:Tbx15 UTSW 3 99351874 missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99316356 unclassified probably null
R2441:Tbx15 UTSW 3 99352511 missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99253893 intron probably benign
R3118:Tbx15 UTSW 3 99352154 missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99313054 missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99352367 missense probably damaging 1.00
R4898:Tbx15 UTSW 3 99352267 missense possibly damaging 0.95
R4950:Tbx15 UTSW 3 99326384 missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99254074 missense probably benign 0.06
R4999:Tbx15 UTSW 3 99316333 missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99352046 missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99316284 missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99352192 missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99352564 missense probably benign
R5690:Tbx15 UTSW 3 99308850 missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99313086 missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6032:Tbx15 UTSW 3 99352517 missense probably benign 0.28
R6156:Tbx15 UTSW 3 99313115 critical splice donor site probably null
R6173:Tbx15 UTSW 3 99253887 nonsense probably null
R6596:Tbx15 UTSW 3 99352192 missense probably benign
R6680:Tbx15 UTSW 3 99313073 nonsense probably null
R6931:Tbx15 UTSW 3 99352151 missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99314835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAATGTGTGCTCAAACATGTGAC -3'
(R):5'- GCCTGCCTGCATGACATACTGAAAC -3'

Sequencing Primer
(F):5'- GTGCTCAAACATGTGACATCATC -3'
(R):5'- TATTCCTGAGATCAGAGATGGAGTCC -3'
Posted On2014-04-13