Incidental Mutation 'R1506:Inppl1'
ID167932
Institutional Source Beutler Lab
Gene Symbol Inppl1
Ensembl Gene ENSMUSG00000032737
Gene Nameinositol polyphosphate phosphatase-like 1
SynonymsSHIP2
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location101822632-101838229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101823967 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 1159 (S1159A)
Ref Sequence ENSEMBL: ENSMUSP00000139910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008090] [ENSMUST00000035836] [ENSMUST00000165052] [ENSMUST00000185929]
Predicted Effect probably benign
Transcript: ENSMUST00000008090
SMART Domains Protein: ENSMUSP00000008090
Gene: ENSMUSG00000007946

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
HOX 90 152 5.75e-27 SMART
low complexity region 183 223 N/A INTRINSIC
low complexity region 225 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035836
AA Change: S1159A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737
AA Change: S1159A

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165052
AA Change: S1159A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737
AA Change: S1159A

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185929
AA Change: S1159A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737
AA Change: S1159A

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000186316
AA Change: S578A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209878
Predicted Effect probably benign
Transcript: ENSMUST00000210116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211436
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice display decreased postnatal growth, decreased circulating levels of leptin, free fatty acids, triglycerides, and total cholesterol, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rad50 G A 11: 53,679,485 A810V probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Inppl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Inppl1 APN 7 101829158 missense probably damaging 1.00
IGL01633:Inppl1 APN 7 101833834 nonsense probably null
IGL01678:Inppl1 APN 7 101832596 missense probably benign 0.09
IGL02420:Inppl1 APN 7 101832319 unclassified probably benign
IGL02423:Inppl1 APN 7 101832243 missense probably benign 0.02
IGL02965:Inppl1 APN 7 101828271 missense possibly damaging 0.87
IGL03329:Inppl1 APN 7 101824380 missense possibly damaging 0.48
PIT4362001:Inppl1 UTSW 7 101826013 missense probably benign 0.34
R0310:Inppl1 UTSW 7 101828499 splice site probably benign
R0355:Inppl1 UTSW 7 101827457 missense probably damaging 1.00
R0394:Inppl1 UTSW 7 101828195 splice site probably benign
R0547:Inppl1 UTSW 7 101831003 missense probably benign 0.02
R0578:Inppl1 UTSW 7 101831588 missense probably damaging 1.00
R1526:Inppl1 UTSW 7 101832946 missense probably benign 0.02
R1901:Inppl1 UTSW 7 101823377 missense possibly damaging 0.85
R2381:Inppl1 UTSW 7 101829232 missense probably damaging 1.00
R3690:Inppl1 UTSW 7 101832068 missense probably damaging 0.99
R4911:Inppl1 UTSW 7 101832309 missense possibly damaging 0.94
R5637:Inppl1 UTSW 7 101828848 missense probably benign 0.08
R6227:Inppl1 UTSW 7 101824299 missense possibly damaging 0.88
R6409:Inppl1 UTSW 7 101828961 missense probably damaging 1.00
R6678:Inppl1 UTSW 7 101832270 missense probably damaging 0.99
R6752:Inppl1 UTSW 7 101832542 nonsense probably null
R7095:Inppl1 UTSW 7 101827456 nonsense probably null
R7196:Inppl1 UTSW 7 101828786 missense probably benign 0.05
R7421:Inppl1 UTSW 7 101832937 missense probably damaging 0.99
R7575:Inppl1 UTSW 7 101828482 missense probably damaging 1.00
R7664:Inppl1 UTSW 7 101830097 missense probably damaging 0.97
R7767:Inppl1 UTSW 7 101824338 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GATGGAACTGATCCATGTGTCCCC -3'
(R):5'- ACCCTGCCTACTACGTCCTTGAAG -3'

Sequencing Primer
(F):5'- TGTGTCCCCCAAAAGGC -3'
(R):5'- TCAATGCCAGTGGTCAGG -3'
Posted On2014-04-13