Incidental Mutation 'R1506:Rad50'
ID167942
Institutional Source Beutler Lab
Gene Symbol Rad50
Ensembl Gene ENSMUSG00000020380
Gene NameRAD50 double strand break repair protein
SynonymsRad50l, Mrell
MMRRC Submission 039554-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1506 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53649519-53707319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53679485 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 810 (A810V)
Ref Sequence ENSEMBL: ENSMUSP00000020649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020649] [ENSMUST00000124352] [ENSMUST00000128483]
Predicted Effect probably damaging
Transcript: ENSMUST00000020649
AA Change: A810V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: A810V

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 1.8e-31 PFAM
coiled coil region 397 534 N/A INTRINSIC
Pfam:Rad50_zn_hook 659 712 9.9e-16 PFAM
low complexity region 825 836 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
coiled coil region 1019 1075 N/A INTRINSIC
Pfam:SbcCD_C 1174 1251 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124352
SMART Domains Protein: ENSMUSP00000119618
Gene: ENSMUSG00000020380

DomainStartEndE-ValueType
Pfam:AAA_23 6 290 2.7e-24 PFAM
coiled coil region 397 469 N/A INTRINSIC
Pfam:Rad50_zn_hook 597 652 1.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126121
Predicted Effect probably benign
Transcript: ENSMUST00000128483
SMART Domains Protein: ENSMUSP00000120869
Gene: ENSMUSG00000020380

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 6e-23 PFAM
coiled coil region 397 534 N/A INTRINSIC
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 G T 11: 94,357,318 T1152K possibly damaging Het
Acpp T A 9: 104,324,174 T82S probably damaging Het
Adam23 C T 1: 63,547,814 P445S probably benign Het
Ap3b1 T A 13: 94,446,143 probably benign Het
Artn A G 4: 117,926,861 V136A probably damaging Het
Ash1l A G 3: 89,058,499 T2403A probably damaging Het
Bbof1 G T 12: 84,423,499 V120L probably damaging Het
Boc A G 16: 44,503,565 Y158H probably damaging Het
Casp8 A G 1: 58,824,196 E105G probably damaging Het
Cers4 T C 8: 4,520,557 F206L probably benign Het
Chrna9 A G 5: 65,969,136 T78A probably benign Het
Creb3 A T 4: 43,566,193 T263S possibly damaging Het
Cyp2c40 A G 19: 39,777,999 V384A probably damaging Het
Dip2b G A 15: 100,183,113 V879M probably damaging Het
Dnah17 C A 11: 118,125,387 V14F possibly damaging Het
Epb41l4b T A 4: 57,088,824 K144N probably damaging Het
Ercc6 A T 14: 32,569,864 I1062F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam160b1 A G 19: 57,368,575 I33V probably benign Het
Fat2 C A 11: 55,284,264 E1874D probably benign Het
Fbxw21 T A 9: 109,148,189 I151F probably damaging Het
Foxn1 A G 11: 78,365,935 probably benign Het
Gm1966 C T 7: 106,601,581 D819N probably benign Het
Gpr63 G A 4: 25,008,227 R317H probably damaging Het
Grip1 C A 10: 119,978,451 H296N probably damaging Het
Gtdc1 A T 2: 44,575,494 M288K possibly damaging Het
Guf1 T A 5: 69,567,166 D488E possibly damaging Het
Heatr5b C A 17: 78,753,147 R2033L probably damaging Het
Hsd17b2 T A 8: 117,702,265 probably null Het
Ino80 A T 2: 119,425,265 L913* probably null Het
Inppl1 A C 7: 101,823,967 S1159A probably benign Het
Kcnk7 G A 19: 5,706,112 C122Y probably damaging Het
Mtor A G 4: 148,536,505 probably benign Het
Muc4 A T 16: 32,752,233 S704C possibly damaging Het
Nckap5 A T 1: 126,025,913 C967* probably null Het
Nek10 T C 14: 14,999,078 probably benign Het
Oas1h A T 5: 120,871,888 D342V possibly damaging Het
Olfr134 A T 17: 38,175,200 M39L probably benign Het
Olfr320 T A 11: 58,684,188 L105Q probably benign Het
Olfr418 A G 1: 173,270,769 N198S probably benign Het
Olfr734 A G 14: 50,320,484 V117A probably benign Het
Olfr904 T C 9: 38,464,143 M34T probably benign Het
Prex1 A T 2: 166,587,081 V694E probably damaging Het
Rcor1 T C 12: 111,109,837 S410P probably damaging Het
Rps14 A T 18: 60,776,479 N26I probably benign Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc5a1 T A 5: 33,154,708 N481K possibly damaging Het
Slco3a1 A T 7: 74,359,935 probably null Het
Speg A G 1: 75,417,663 T1701A probably benign Het
Spg20 T C 3: 55,117,571 S196P probably damaging Het
Sugt1 A G 14: 79,624,925 N271S probably benign Het
Tbx15 A T 3: 99,351,912 L366F possibly damaging Het
Tnc G A 4: 64,007,684 T953I possibly damaging Het
Uqcc1 A G 2: 155,911,818 S46P probably damaging Het
Vmn2r18 T C 5: 151,575,634 probably null Het
Vmn2r7 T A 3: 64,707,079 Y438F probably benign Het
Vmn2r72 T A 7: 85,749,211 K520N probably benign Het
Vps52 T C 17: 33,957,894 L74P probably damaging Het
Xpo5 G T 17: 46,227,888 M673I probably benign Het
Zscan18 A G 7: 12,774,202 V457A probably damaging Het
Other mutations in Rad50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Rad50 APN 11 53686311 intron probably benign
IGL00709:Rad50 APN 11 53669642 missense possibly damaging 0.49
IGL01080:Rad50 APN 11 53706068 missense probably damaging 1.00
IGL01357:Rad50 APN 11 53707021 missense probably damaging 1.00
IGL01979:Rad50 APN 11 53686178 nonsense probably null
IGL02481:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02483:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02673:Rad50 APN 11 53688240 missense probably benign 0.19
IGL02754:Rad50 APN 11 53702056 missense probably damaging 1.00
IGL03372:Rad50 APN 11 53695294 missense probably benign 0.20
PIT4131001:Rad50 UTSW 11 53694899 critical splice donor site probably null
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0270:Rad50 UTSW 11 53668025 missense probably damaging 1.00
R0373:Rad50 UTSW 11 53650519 missense probably damaging 1.00
R0567:Rad50 UTSW 11 53654956 missense probably damaging 1.00
R1132:Rad50 UTSW 11 53694961 missense possibly damaging 0.58
R1249:Rad50 UTSW 11 53692137 missense probably damaging 0.99
R1368:Rad50 UTSW 11 53683245 nonsense probably null
R1501:Rad50 UTSW 11 53688151 missense possibly damaging 0.68
R1633:Rad50 UTSW 11 53692859 missense probably benign 0.00
R1663:Rad50 UTSW 11 53668223 missense probably benign 0.01
R1847:Rad50 UTSW 11 53702107 missense possibly damaging 0.68
R1933:Rad50 UTSW 11 53680061 missense probably benign 0.16
R2176:Rad50 UTSW 11 53698209 missense probably benign 0.00
R2519:Rad50 UTSW 11 53707185 start gained probably benign
R3027:Rad50 UTSW 11 53695381 missense probably benign 0.00
R3894:Rad50 UTSW 11 53678870 missense probably benign 0.01
R4181:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4302:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4836:Rad50 UTSW 11 53650653 missense probably damaging 1.00
R4934:Rad50 UTSW 11 53684275 missense probably benign 0.05
R5047:Rad50 UTSW 11 53674696 critical splice donor site probably null
R5201:Rad50 UTSW 11 53698820 critical splice donor site probably null
R5325:Rad50 UTSW 11 53692863 missense probably benign 0.16
R5368:Rad50 UTSW 11 53684246 missense probably benign 0.02
R5403:Rad50 UTSW 11 53695281 critical splice donor site probably null
R5421:Rad50 UTSW 11 53674946 missense probably benign 0.02
R6282:Rad50 UTSW 11 53669770 splice site probably null
R6468:Rad50 UTSW 11 53692144 missense possibly damaging 0.81
R6469:Rad50 UTSW 11 53684235 missense probably benign 0.08
R6528:Rad50 UTSW 11 53652282 missense probably damaging 1.00
R6704:Rad50 UTSW 11 53698918 missense probably damaging 1.00
R6886:Rad50 UTSW 11 53686184 missense probably benign 0.01
R7055:Rad50 UTSW 11 53688102 missense probably benign 0.02
R7268:Rad50 UTSW 11 53684275 missense probably benign 0.01
R7288:Rad50 UTSW 11 53654949 nonsense probably null
R7375:Rad50 UTSW 11 53652228 splice site probably null
R7380:Rad50 UTSW 11 53695396 missense probably benign 0.00
R7467:Rad50 UTSW 11 53654908 missense probably damaging 1.00
R7533:Rad50 UTSW 11 53698919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGGCAAAGCAGGCAAGC -3'
(R):5'- GTTCCAGGTAAGCCGCTGTAGTTC -3'

Sequencing Primer
(F):5'- GGCAAGCAGAGACACTTGG -3'
(R):5'- tggagaggcagaggcag -3'
Posted On2014-04-13