Incidental Mutation 'R1507:Rapgef2'
ID167978
Institutional Source Beutler Lab
Gene Symbol Rapgef2
Ensembl Gene ENSMUSG00000062232
Gene NameRap guanine nucleotide exchange factor (GEF) 2
SynonymsCNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik
MMRRC Submission 039555-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1507 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79062516-79286517 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 79081293 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]
Predicted Effect probably benign
Transcript: ENSMUST00000118100
SMART Domains Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232

DomainStartEndE-ValueType
low complexity region 38 62 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
cNMP 135 253 2.48e-15 SMART
RasGEFN 267 380 1.3e-31 SMART
PDZ 395 467 1.28e-12 SMART
RA 606 692 7.59e-23 SMART
RasGEF 713 950 6.09e-100 SMART
low complexity region 1030 1046 N/A INTRINSIC
low complexity region 1110 1124 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
low complexity region 1440 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118340
SMART Domains Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232

DomainStartEndE-ValueType
low complexity region 36 60 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
cNMP 133 251 2.48e-15 SMART
RasGEFN 265 378 1.3e-31 SMART
PDZ 393 465 1.28e-12 SMART
RA 604 690 7.59e-23 SMART
RasGEF 711 948 6.09e-100 SMART
low complexity region 1028 1044 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1138 1159 N/A INTRINSIC
low complexity region 1390 1403 N/A INTRINSIC
low complexity region 1438 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195708
SMART Domains Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232

DomainStartEndE-ValueType
cNMP 24 131 3.9e-4 SMART
low complexity region 186 210 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
cNMP 283 401 1.2e-17 SMART
RasGEFN 415 528 6.4e-34 SMART
PDZ 543 615 6.4e-15 SMART
RA 754 840 4.8e-25 SMART
RasGEF 861 1098 3.8e-102 SMART
low complexity region 1178 1194 N/A INTRINSIC
low complexity region 1258 1272 N/A INTRINSIC
low complexity region 1288 1309 N/A INTRINSIC
low complexity region 1540 1553 N/A INTRINSIC
low complexity region 1588 1603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik T G 2: 154,549,619 V102G probably benign Het
4931423N10Rik A G 2: 23,208,074 Y88C probably damaging Het
Adgrv1 T C 13: 81,472,580 probably null Het
Ahnak T A 19: 9,010,077 D2908E probably damaging Het
Aox1 A G 1: 58,104,451 M1243V probably benign Het
Apobec2 T C 17: 48,422,975 D221G possibly damaging Het
Bcas1 T C 2: 170,366,428 D472G probably damaging Het
Btnl7-ps T A 17: 34,541,463 noncoding transcript Het
Cd209d G T 8: 3,878,453 Q11K possibly damaging Het
Cdc14a G A 3: 116,293,997 T455I possibly damaging Het
Cep120 A G 18: 53,697,657 S843P probably damaging Het
Cped1 A T 6: 22,122,261 H380L probably damaging Het
D430042O09Rik T A 7: 125,866,352 D1325E probably damaging Het
Derl2 A T 11: 71,007,345 W233R probably benign Het
Drd5 A T 5: 38,320,722 I353F probably damaging Het
E330034G19Rik A T 14: 24,306,987 Q197L possibly damaging Het
Edil3 T A 13: 89,131,712 S170T probably damaging Het
Gldc T A 19: 30,118,638 T658S probably damaging Het
Gpr146 A G 5: 139,393,369 M309V probably benign Het
Hexim2 T A 11: 103,138,321 C66* probably null Het
Hist2h2bb A G 3: 96,269,873 Y41C probably damaging Het
Htr2a T C 14: 74,705,979 V333A probably damaging Het
Igdcc4 A G 9: 65,133,744 E1065G probably damaging Het
Kcnk9 T A 15: 72,512,234 E365V possibly damaging Het
Kif28 T A 1: 179,736,006 N135I probably damaging Het
Kmt2a A T 9: 44,818,403 probably benign Het
Lamb2 A T 9: 108,490,382 I1788F probably damaging Het
Lsm6 G A 8: 78,812,979 R31* probably null Het
Mical3 T A 6: 121,042,238 T8S probably benign Het
Ncapg2 T C 12: 116,460,566 F1123S probably benign Het
Nprl2 A G 9: 107,542,992 D30G probably benign Het
Olfr206 A T 16: 59,345,493 D69E probably damaging Het
Olfr630 C T 7: 103,755,021 R188H probably benign Het
Olfr916 A T 9: 38,658,014 I126N probably damaging Het
Parvg T A 15: 84,330,158 V181E probably damaging Het
Pfas T C 11: 68,990,034 T1106A probably benign Het
Plekhh1 A T 12: 79,079,450 T1310S probably damaging Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rfx3 G T 19: 27,768,513 T731K probably benign Het
Rnf31 A T 14: 55,598,982 K634* probably null Het
Scp2 CACTTTAATAATACTTT CACTTT 4: 108,087,012 probably null Het
Set A G 2: 30,069,094 H101R probably damaging Het
Slc30a6 G T 17: 74,408,862 V106F probably damaging Het
Slc47a1 A T 11: 61,359,518 probably null Het
Spaca3 G A 11: 80,863,157 R40H probably damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Tenm3 A G 8: 48,287,822 S1209P probably benign Het
Tmprss11g T C 5: 86,499,611 T23A probably benign Het
Topors A G 4: 40,261,829 V485A probably damaging Het
Tpgs1 T A 10: 79,675,786 L254Q probably damaging Het
Traf3 A C 12: 111,260,760 T336P probably benign Het
Ttn T A 2: 76,880,590 probably benign Het
Ubr5 G A 15: 37,980,870 R2388W probably damaging Het
Unc13a A G 8: 71,658,266 S434P probably benign Het
Usp33 A G 3: 152,374,763 I510M possibly damaging Het
Vmn1r65 C A 7: 6,009,109 G42V probably benign Het
Xab2 A G 8: 3,616,031 L262S possibly damaging Het
Yap1 A T 9: 7,953,140 probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfp609 A G 9: 65,794,777 Y198H possibly damaging Het
Zfp629 T A 7: 127,611,861 K259* probably null Het
Other mutations in Rapgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rapgef2 APN 3 79092025 missense possibly damaging 0.89
IGL01024:Rapgef2 APN 3 79070138 missense probably benign 0.43
IGL01448:Rapgef2 APN 3 79068937 missense probably benign
IGL01448:Rapgef2 APN 3 79103962 critical splice donor site probably null
IGL01928:Rapgef2 APN 3 79103963 missense probably damaging 1.00
IGL01973:Rapgef2 APN 3 79091809 splice site probably null
IGL02015:Rapgef2 APN 3 79092064 splice site probably benign
IGL02498:Rapgef2 APN 3 79066753 missense probably damaging 0.97
IGL02631:Rapgef2 APN 3 79083226 missense possibly damaging 0.77
IGL02835:Rapgef2 APN 3 79092986 splice site probably benign
IGL02887:Rapgef2 APN 3 79068880 splice site probably benign
IGL03030:Rapgef2 APN 3 79074307 critical splice donor site probably null
IGL03035:Rapgef2 APN 3 79094424 missense probably damaging 1.00
IGL03222:Rapgef2 APN 3 79087995 missense probably damaging 1.00
IGL03227:Rapgef2 APN 3 79092613 splice site probably benign
IGL03326:Rapgef2 APN 3 79091833 missense probably damaging 0.96
IGL03335:Rapgef2 APN 3 79099185 missense probably damaging 1.00
IGL03384:Rapgef2 APN 3 79083546 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0038:Rapgef2 UTSW 3 79069396 missense probably benign 0.00
R0117:Rapgef2 UTSW 3 79079177 missense probably benign 0.00
R0225:Rapgef2 UTSW 3 79104105 missense probably damaging 0.99
R0723:Rapgef2 UTSW 3 79079174 missense probably benign 0.20
R0788:Rapgef2 UTSW 3 79099195 missense possibly damaging 0.59
R1311:Rapgef2 UTSW 3 79083547 missense probably benign 0.12
R1374:Rapgef2 UTSW 3 79087968 missense probably benign 0.08
R1523:Rapgef2 UTSW 3 79092749 missense probably damaging 1.00
R1753:Rapgef2 UTSW 3 79088791 missense possibly damaging 0.65
R1759:Rapgef2 UTSW 3 79066731 missense possibly damaging 0.89
R1766:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R2436:Rapgef2 UTSW 3 79088772 missense possibly damaging 0.95
R3033:Rapgef2 UTSW 3 79074306 critical splice donor site probably null
R3766:Rapgef2 UTSW 3 79088750 missense probably benign 0.01
R4118:Rapgef2 UTSW 3 79068887 critical splice donor site probably null
R4416:Rapgef2 UTSW 3 79069057 nonsense probably null
R4722:Rapgef2 UTSW 3 79069173 missense probably benign 0.00
R4743:Rapgef2 UTSW 3 79173068 missense probably damaging 0.99
R4780:Rapgef2 UTSW 3 79169769 splice site probably benign
R4825:Rapgef2 UTSW 3 79083227 missense probably benign 0.03
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4900:Rapgef2 UTSW 3 79074363 missense probably benign 0.02
R4943:Rapgef2 UTSW 3 79064547 missense probably benign 0.00
R5291:Rapgef2 UTSW 3 79070059 missense possibly damaging 0.64
R5369:Rapgef2 UTSW 3 79069432 missense probably benign 0.00
R5413:Rapgef2 UTSW 3 79087866 missense probably damaging 1.00
R5561:Rapgef2 UTSW 3 79088643 critical splice donor site probably null
R5568:Rapgef2 UTSW 3 79104001 missense probably damaging 1.00
R5642:Rapgef2 UTSW 3 79094850 missense probably damaging 1.00
R5783:Rapgef2 UTSW 3 79087993 missense probably benign 0.00
R6041:Rapgef2 UTSW 3 79069162 missense probably benign 0.00
R6193:Rapgef2 UTSW 3 79069444 missense possibly damaging 0.48
R6324:Rapgef2 UTSW 3 79079132 missense probably benign 0.01
R6551:Rapgef2 UTSW 3 79215035 splice site probably null
R6688:Rapgef2 UTSW 3 79069128 missense probably benign 0.03
R6908:Rapgef2 UTSW 3 79104063 missense probably benign 0.01
R6913:Rapgef2 UTSW 3 79085974 missense probably damaging 1.00
R6933:Rapgef2 UTSW 3 79085959 missense probably damaging 1.00
R7086:Rapgef2 UTSW 3 79086046 missense probably benign 0.08
R7106:Rapgef2 UTSW 3 79066608 missense probably benign
R7228:Rapgef2 UTSW 3 79069218 missense probably benign 0.03
R7242:Rapgef2 UTSW 3 79087903 nonsense probably null
R7257:Rapgef2 UTSW 3 79082627 missense probably damaging 0.99
R7322:Rapgef2 UTSW 3 79145823 start codon destroyed probably null 0.02
R7443:Rapgef2 UTSW 3 79081224 missense probably damaging 1.00
R7450:Rapgef2 UTSW 3 79173059 missense probably benign 0.01
R7472:Rapgef2 UTSW 3 79069273 missense probably benign 0.45
R7884:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
R7967:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGCTCCAGGTTGGACAGGTATTGC -3'
(R):5'- GGCTTCTGTGAGAGAACGGACTTTG -3'

Sequencing Primer
(F):5'- GGACAGGTATTGCTTCACTTTC -3'
(R):5'- GAGAACGGACTTTGAATGCTC -3'
Posted On2014-04-13