Incidental Mutation 'R1507:Olfr630'
ID167992
Institutional Source Beutler Lab
Gene Symbol Olfr630
Ensembl Gene ENSMUSG00000050281
Gene Nameolfactory receptor 630
SynonymsMOR17-1, GA_x6K02T2PBJ9-6483085-6482126
MMRRC Submission 039555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1507 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103753480-103757333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103755021 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 188 (R188H)
Ref Sequence ENSEMBL: ENSMUSP00000102493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106880]
Predicted Effect probably benign
Transcript: ENSMUST00000052826
AA Change: R188H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000049569
Gene: ENSMUSG00000050281
AA Change: R188H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.4e-120 PFAM
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106880
AA Change: R188H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000102493
Gene: ENSMUSG00000050281
AA Change: R188H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 8.4e-25 PFAM
Pfam:7tm_4 144 287 9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217072
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik T G 2: 154,549,619 V102G probably benign Het
4931423N10Rik A G 2: 23,208,074 Y88C probably damaging Het
Adgrv1 T C 13: 81,472,580 probably null Het
Ahnak T A 19: 9,010,077 D2908E probably damaging Het
Aox1 A G 1: 58,104,451 M1243V probably benign Het
Apobec2 T C 17: 48,422,975 D221G possibly damaging Het
Bcas1 T C 2: 170,366,428 D472G probably damaging Het
Btnl7-ps T A 17: 34,541,463 noncoding transcript Het
Cd209d G T 8: 3,878,453 Q11K possibly damaging Het
Cdc14a G A 3: 116,293,997 T455I possibly damaging Het
Cep120 A G 18: 53,697,657 S843P probably damaging Het
Cped1 A T 6: 22,122,261 H380L probably damaging Het
D430042O09Rik T A 7: 125,866,352 D1325E probably damaging Het
Derl2 A T 11: 71,007,345 W233R probably benign Het
Drd5 A T 5: 38,320,722 I353F probably damaging Het
E330034G19Rik A T 14: 24,306,987 Q197L possibly damaging Het
Edil3 T A 13: 89,131,712 S170T probably damaging Het
Gldc T A 19: 30,118,638 T658S probably damaging Het
Gpr146 A G 5: 139,393,369 M309V probably benign Het
Hexim2 T A 11: 103,138,321 C66* probably null Het
Hist2h2bb A G 3: 96,269,873 Y41C probably damaging Het
Htr2a T C 14: 74,705,979 V333A probably damaging Het
Igdcc4 A G 9: 65,133,744 E1065G probably damaging Het
Kcnk9 T A 15: 72,512,234 E365V possibly damaging Het
Kif28 T A 1: 179,736,006 N135I probably damaging Het
Kmt2a A T 9: 44,818,403 probably benign Het
Lamb2 A T 9: 108,490,382 I1788F probably damaging Het
Lsm6 G A 8: 78,812,979 R31* probably null Het
Mical3 T A 6: 121,042,238 T8S probably benign Het
Ncapg2 T C 12: 116,460,566 F1123S probably benign Het
Nprl2 A G 9: 107,542,992 D30G probably benign Het
Olfr206 A T 16: 59,345,493 D69E probably damaging Het
Olfr916 A T 9: 38,658,014 I126N probably damaging Het
Parvg T A 15: 84,330,158 V181E probably damaging Het
Pfas T C 11: 68,990,034 T1106A probably benign Het
Plekhh1 A T 12: 79,079,450 T1310S probably damaging Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef2 A T 3: 79,081,293 probably benign Het
Rfx3 G T 19: 27,768,513 T731K probably benign Het
Rnf31 A T 14: 55,598,982 K634* probably null Het
Scp2 CACTTTAATAATACTTT CACTTT 4: 108,087,012 probably null Het
Set A G 2: 30,069,094 H101R probably damaging Het
Slc30a6 G T 17: 74,408,862 V106F probably damaging Het
Slc47a1 A T 11: 61,359,518 probably null Het
Spaca3 G A 11: 80,863,157 R40H probably damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Tenm3 A G 8: 48,287,822 S1209P probably benign Het
Tmprss11g T C 5: 86,499,611 T23A probably benign Het
Topors A G 4: 40,261,829 V485A probably damaging Het
Tpgs1 T A 10: 79,675,786 L254Q probably damaging Het
Traf3 A C 12: 111,260,760 T336P probably benign Het
Ttn T A 2: 76,880,590 probably benign Het
Ubr5 G A 15: 37,980,870 R2388W probably damaging Het
Unc13a A G 8: 71,658,266 S434P probably benign Het
Usp33 A G 3: 152,374,763 I510M possibly damaging Het
Vmn1r65 C A 7: 6,009,109 G42V probably benign Het
Xab2 A G 8: 3,616,031 L262S possibly damaging Het
Yap1 A T 9: 7,953,140 probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfp609 A G 9: 65,794,777 Y198H possibly damaging Het
Zfp629 T A 7: 127,611,861 K259* probably null Het
Other mutations in Olfr630
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr630 APN 7 103755006 missense probably damaging 1.00
IGL01111:Olfr630 APN 7 103755373 missense probably benign 0.07
IGL02456:Olfr630 APN 7 103755493 missense possibly damaging 0.94
IGL03173:Olfr630 APN 7 103754976 missense probably benign 0.00
R1104:Olfr630 UTSW 7 103754976 missense probably benign 0.00
R1695:Olfr630 UTSW 7 103754924 nonsense probably null
R1966:Olfr630 UTSW 7 103755168 missense probably damaging 1.00
R1971:Olfr630 UTSW 7 103755320 nonsense probably null
R2696:Olfr630 UTSW 7 103755528 missense probably damaging 0.96
R4943:Olfr630 UTSW 7 103755296 missense probably benign 0.12
R5622:Olfr630 UTSW 7 103755169 missense probably damaging 0.99
R6365:Olfr630 UTSW 7 103755195 missense probably benign 0.00
R7592:Olfr630 UTSW 7 103755072 missense probably damaging 1.00
R8146:Olfr630 UTSW 7 103755303 missense probably damaging 1.00
R8283:Olfr630 UTSW 7 103754812 missense possibly damaging 0.51
R8867:Olfr630 UTSW 7 103754686 nonsense probably null
R8875:Olfr630 UTSW 7 103755255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTCTTGACTTGATGACATGCC -3'
(R):5'- CATTCTCACGCCGAAACTTATTGCC -3'

Sequencing Primer
(F):5'- CATGGGCACATATAGAATTAGCAC -3'
(R):5'- CAAGATTGGAACTGCTGCTC -3'
Posted On2014-04-13