Incidental Mutation 'R1507:Htr2a'
ID168024
Institutional Source Beutler Lab
Gene Symbol Htr2a
Ensembl Gene ENSMUSG00000034997
Gene Name5-hydroxytryptamine (serotonin) receptor 2A
SynonymsHtr2, 5-HT2A receptor, Htr-2
MMRRC Submission 039555-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1507 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location74640840-74709494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74705979 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 333 (V333A)
Ref Sequence ENSEMBL: ENSMUSP00000047774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036653]
Predicted Effect probably damaging
Transcript: ENSMUST00000036653
AA Change: V333A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047774
Gene: ENSMUSG00000034997
AA Change: V333A

DomainStartEndE-ValueType
Pfam:7tm_4 81 264 1.2e-9 PFAM
Pfam:7TM_GPCR_Srx 82 289 1e-6 PFAM
Pfam:7TM_GPCR_Srsx 85 395 1.1e-16 PFAM
Pfam:7tm_1 91 380 5.9e-70 PFAM
Meta Mutation Damage Score 0.5777 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show altered anxiety-related responses and increased vertical activity. Mice homozygous for a different knock-out allele exhibit abnormal enterocyte, Paneth cell and smooth muscle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik T G 2: 154,549,619 V102G probably benign Het
4931423N10Rik A G 2: 23,208,074 Y88C probably damaging Het
Adgrv1 T C 13: 81,472,580 probably null Het
Ahnak T A 19: 9,010,077 D2908E probably damaging Het
Aox1 A G 1: 58,104,451 M1243V probably benign Het
Apobec2 T C 17: 48,422,975 D221G possibly damaging Het
Bcas1 T C 2: 170,366,428 D472G probably damaging Het
Btnl7-ps T A 17: 34,541,463 noncoding transcript Het
Cd209d G T 8: 3,878,453 Q11K possibly damaging Het
Cdc14a G A 3: 116,293,997 T455I possibly damaging Het
Cep120 A G 18: 53,697,657 S843P probably damaging Het
Cped1 A T 6: 22,122,261 H380L probably damaging Het
D430042O09Rik T A 7: 125,866,352 D1325E probably damaging Het
Derl2 A T 11: 71,007,345 W233R probably benign Het
Drd5 A T 5: 38,320,722 I353F probably damaging Het
E330034G19Rik A T 14: 24,306,987 Q197L possibly damaging Het
Edil3 T A 13: 89,131,712 S170T probably damaging Het
Gldc T A 19: 30,118,638 T658S probably damaging Het
Gpr146 A G 5: 139,393,369 M309V probably benign Het
Hexim2 T A 11: 103,138,321 C66* probably null Het
Hist2h2bb A G 3: 96,269,873 Y41C probably damaging Het
Igdcc4 A G 9: 65,133,744 E1065G probably damaging Het
Kcnk9 T A 15: 72,512,234 E365V possibly damaging Het
Kif28 T A 1: 179,736,006 N135I probably damaging Het
Kmt2a A T 9: 44,818,403 probably benign Het
Lamb2 A T 9: 108,490,382 I1788F probably damaging Het
Lsm6 G A 8: 78,812,979 R31* probably null Het
Mical3 T A 6: 121,042,238 T8S probably benign Het
Ncapg2 T C 12: 116,460,566 F1123S probably benign Het
Nprl2 A G 9: 107,542,992 D30G probably benign Het
Olfr206 A T 16: 59,345,493 D69E probably damaging Het
Olfr630 C T 7: 103,755,021 R188H probably benign Het
Olfr916 A T 9: 38,658,014 I126N probably damaging Het
Parvg T A 15: 84,330,158 V181E probably damaging Het
Pfas T C 11: 68,990,034 T1106A probably benign Het
Plekhh1 A T 12: 79,079,450 T1310S probably damaging Het
Ptprj A G 2: 90,471,287 V74A possibly damaging Het
Rapgef2 A T 3: 79,081,293 probably benign Het
Rfx3 G T 19: 27,768,513 T731K probably benign Het
Rnf31 A T 14: 55,598,982 K634* probably null Het
Scp2 CACTTTAATAATACTTT CACTTT 4: 108,087,012 probably null Het
Set A G 2: 30,069,094 H101R probably damaging Het
Slc30a6 G T 17: 74,408,862 V106F probably damaging Het
Slc47a1 A T 11: 61,359,518 probably null Het
Spaca3 G A 11: 80,863,157 R40H probably damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Ston2 A T 12: 91,641,680 I882N probably benign Het
Tenm3 A G 8: 48,287,822 S1209P probably benign Het
Tmprss11g T C 5: 86,499,611 T23A probably benign Het
Topors A G 4: 40,261,829 V485A probably damaging Het
Tpgs1 T A 10: 79,675,786 L254Q probably damaging Het
Traf3 A C 12: 111,260,760 T336P probably benign Het
Ttn T A 2: 76,880,590 probably benign Het
Ubr5 G A 15: 37,980,870 R2388W probably damaging Het
Unc13a A G 8: 71,658,266 S434P probably benign Het
Usp33 A G 3: 152,374,763 I510M possibly damaging Het
Vmn1r65 C A 7: 6,009,109 G42V probably benign Het
Xab2 A G 8: 3,616,031 L262S possibly damaging Het
Yap1 A T 9: 7,953,140 probably benign Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfp609 A G 9: 65,794,777 Y198H possibly damaging Het
Zfp629 T A 7: 127,611,861 K259* probably null Het
Other mutations in Htr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Htr2a APN 14 74706205 missense possibly damaging 0.93
IGL00946:Htr2a APN 14 74706142 nonsense probably null
IGL01660:Htr2a APN 14 74705754 missense probably damaging 1.00
IGL02200:Htr2a APN 14 74706165 missense probably damaging 1.00
IGL02369:Htr2a APN 14 74706282 missense probably benign 0.17
IGL02724:Htr2a APN 14 74645062 missense probably damaging 1.00
IGL02887:Htr2a APN 14 74645143 missense probably benign 0.05
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0038:Htr2a UTSW 14 74706247 missense probably benign 0.00
R0117:Htr2a UTSW 14 74645093 missense probably damaging 1.00
R0367:Htr2a UTSW 14 74642209 missense probably damaging 1.00
R0513:Htr2a UTSW 14 74706324 missense probably benign 0.00
R0729:Htr2a UTSW 14 74642147 missense probably benign
R1522:Htr2a UTSW 14 74705853 nonsense probably null
R1539:Htr2a UTSW 14 74645168 missense possibly damaging 0.66
R1735:Htr2a UTSW 14 74706128 missense probably damaging 1.00
R1747:Htr2a UTSW 14 74706153 missense probably damaging 1.00
R1854:Htr2a UTSW 14 74705753 missense probably damaging 1.00
R2232:Htr2a UTSW 14 74645029 missense probably damaging 1.00
R2348:Htr2a UTSW 14 74645110 missense probably damaging 1.00
R3154:Htr2a UTSW 14 74705822 missense probably benign 0.00
R3401:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4006:Htr2a UTSW 14 74642141 missense probably benign
R4007:Htr2a UTSW 14 74642141 missense probably benign
R4093:Htr2a UTSW 14 74706349 missense probably benign
R4094:Htr2a UTSW 14 74706349 missense probably benign
R4095:Htr2a UTSW 14 74706349 missense probably benign
R4502:Htr2a UTSW 14 74641988 missense probably benign 0.02
R4720:Htr2a UTSW 14 74645059 missense probably damaging 1.00
R4932:Htr2a UTSW 14 74642022 missense probably benign
R5651:Htr2a UTSW 14 74705703 missense probably damaging 0.98
R5935:Htr2a UTSW 14 74645090 missense probably damaging 1.00
R6175:Htr2a UTSW 14 74645034 nonsense probably null
R6937:Htr2a UTSW 14 74645164 missense probably damaging 0.98
R7138:Htr2a UTSW 14 74705742 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAGCACTCGGGCCAAATTATC -3'
(R):5'- TCATTAGCTGTCGGCTCAGCATC -3'

Sequencing Primer
(F):5'- GGGCCAAATTATCCTCCTTCAG -3'
(R):5'- TACTGGCACTGAATGTACCG -3'
Posted On2014-04-13