Incidental Mutation 'R1508:Olfr625-ps1'
ID168066
Institutional Source Beutler Lab
Gene Symbol Olfr625-ps1
Ensembl Gene ENSMUSG00000073943
Gene Nameolfactory receptor 625, pseudogene 1
SynonymsMOR31-15P, GA_x6K02T2PBJ9-6416276-6417237
MMRRC Submission 040869-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1508 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103682720-103683685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103683471 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 251 (V251A)
Ref Sequence ENSEMBL: ENSMUSP00000095797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098195] [ENSMUST00000190218]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098195
AA Change: V251A

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095797
Gene: ENSMUSG00000073943
AA Change: V251A

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 8.1e-110 PFAM
Pfam:7TM_GPCR_Srsx 41 225 3.6e-9 PFAM
Pfam:7tm_1 47 299 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190218
AA Change: V241A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140044
Gene: ENSMUSG00000073943
AA Change: V241A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 31 214 7e-8 PFAM
Pfam:7tm_1 37 289 2.8e-26 PFAM
Pfam:7tm_4 136 282 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik A G 5: 90,581,921 E401G probably benign Het
Agbl4 T C 4: 111,656,398 I447T probably benign Het
Alpk2 C A 18: 65,349,305 G544V probably damaging Het
Apob T C 12: 8,011,481 I3321T possibly damaging Het
Ccdc47 C T 11: 106,202,416 D70N probably damaging Het
Ceacam13 T A 7: 18,011,071 V22D possibly damaging Het
Cep76 A G 18: 67,623,288 M491T probably damaging Het
Clec4a3 A T 6: 122,967,508 N171I probably benign Het
Col20a1 A G 2: 180,992,577 I112V probably damaging Het
Col4a4 A T 1: 82,455,836 L1462H unknown Het
Cubn A G 2: 13,427,105 F1226L probably benign Het
Cyp4a31 T A 4: 115,565,053 I77K possibly damaging Het
Dcaf1 A T 9: 106,854,177 T618S probably damaging Het
Echdc3 A T 2: 6,206,420 S129T probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fat1 T C 8: 45,026,862 F2982L probably benign Het
Gm11639 T C 11: 104,710,677 V272A probably benign Het
Gm9476 A T 10: 100,306,838 noncoding transcript Het
Golga1 A G 2: 39,023,249 M542T probably benign Het
H2-D1 T A 17: 35,263,868 C125S probably damaging Het
Jazf1 G A 6: 52,812,181 H103Y probably damaging Het
Klhl12 T C 1: 134,488,974 V478A possibly damaging Het
Lpcat2b A T 5: 107,433,464 T220S probably damaging Het
Myocd C T 11: 65,184,516 C594Y probably damaging Het
Nf1 A G 11: 79,440,909 E700G probably damaging Het
Olfr420 T A 1: 174,159,364 M197K possibly damaging Het
Papln A G 12: 83,782,916 Q937R probably damaging Het
Pex14 T C 4: 148,967,572 R147G probably damaging Het
Plppr3 A T 10: 79,867,540 Y37N probably damaging Het
Polr1b A G 2: 129,113,734 T522A probably benign Het
Ppp3cb T C 14: 20,524,424 N201S probably damaging Het
Prf1 A G 10: 61,303,550 D429G probably damaging Het
Ptprn2 T C 12: 117,184,722 S701P probably damaging Het
Rp1l1 C T 14: 64,030,892 T1309I possibly damaging Het
Sipa1l1 T A 12: 82,440,893 M1647K probably damaging Het
Skint11 T C 4: 114,231,766 probably null Het
Slc8a2 T C 7: 16,140,597 Y257H probably benign Het
Slfn1 T A 11: 83,121,355 I99N probably damaging Het
Slit2 A G 5: 48,192,249 T282A probably damaging Het
Slit3 A T 11: 35,570,621 D228V probably damaging Het
Specc1l A G 10: 75,307,238 N1031S probably benign Het
Supt6 A G 11: 78,216,203 probably null Het
Tdrd1 G A 19: 56,851,358 E617K probably damaging Het
Tex15 C G 8: 33,576,852 F2103L probably damaging Het
Trim21 T A 7: 102,559,576 Q312L possibly damaging Het
Trim56 C T 5: 137,113,937 A242T probably benign Het
Usp4 T C 9: 108,372,674 V467A probably benign Het
Vmn2r65 T A 7: 84,940,678 I677L probably benign Het
Vstm4 T C 14: 32,863,554 V26A probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zfat T A 15: 68,178,751 K807I probably damaging Het
Other mutations in Olfr625-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02547:Olfr625-ps1 APN 7 103682766 missense probably benign 0.01
R1160:Olfr625-ps1 UTSW 7 103682861 missense possibly damaging 0.50
R1766:Olfr625-ps1 UTSW 7 103682861 missense possibly damaging 0.50
R1901:Olfr625-ps1 UTSW 7 103683543 missense probably damaging 0.98
R2116:Olfr625-ps1 UTSW 7 103683312 missense probably damaging 1.00
R4701:Olfr625-ps1 UTSW 7 103683062 missense probably damaging 1.00
R4995:Olfr625-ps1 UTSW 7 103683367 missense probably damaging 1.00
R5198:Olfr625-ps1 UTSW 7 103682729 missense probably benign 0.40
R5750:Olfr625-ps1 UTSW 7 103683155 missense possibly damaging 0.95
R5776:Olfr625-ps1 UTSW 7 103683039 missense probably damaging 1.00
R5905:Olfr625-ps1 UTSW 7 103683574 missense probably damaging 1.00
R5933:Olfr625-ps1 UTSW 7 103683473 missense probably damaging 1.00
R6488:Olfr625-ps1 UTSW 7 103683078 missense probably damaging 0.98
R7846:Olfr625-ps1 UTSW 7 103683200 missense probably benign 0.03
R7878:Olfr625-ps1 UTSW 7 103683264 missense probably damaging 1.00
RF040:Olfr625-ps1 UTSW 7 103682938 frame shift probably null
Z1088:Olfr625-ps1 UTSW 7 103683186 missense probably benign 0.01
Z1176:Olfr625-ps1 UTSW 7 103683105 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACTCATACTGTGAACACATGGGCATTG -3'
(R):5'- GCTGTAATCACCCTCAGAAATGGTGAC -3'

Sequencing Primer
(F):5'- ACATGGGCATTGCCAGG -3'
(R):5'- TCACCCTCAGAAATGGTGACTTAAC -3'
Posted On2014-04-13