Incidental Mutation 'R1508:Ptprn2'
ID 168088
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 040869-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R1508 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117148342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 701 (S701P)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably damaging
Transcript: ENSMUST00000070733
AA Change: S701P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: S701P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190247
AA Change: S701P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: S701P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 T C 4: 111,513,595 (GRCm39) I447T probably benign Het
Albfm1 A G 5: 90,729,780 (GRCm39) E401G probably benign Het
Alpk2 C A 18: 65,482,376 (GRCm39) G544V probably damaging Het
Apob T C 12: 8,061,481 (GRCm39) I3321T possibly damaging Het
Ccdc47 C T 11: 106,093,242 (GRCm39) D70N probably damaging Het
Ceacam13 T A 7: 17,744,996 (GRCm39) V22D possibly damaging Het
Cep76 A G 18: 67,756,358 (GRCm39) M491T probably damaging Het
Clec4a3 A T 6: 122,944,467 (GRCm39) N171I probably benign Het
Col20a1 A G 2: 180,634,370 (GRCm39) I112V probably damaging Het
Col4a4 A T 1: 82,433,557 (GRCm39) L1462H unknown Het
Cubn A G 2: 13,431,916 (GRCm39) F1226L probably benign Het
Cyp4a31 T A 4: 115,422,250 (GRCm39) I77K possibly damaging Het
Dcaf1 A T 9: 106,731,376 (GRCm39) T618S probably damaging Het
Echdc3 A T 2: 6,211,231 (GRCm39) S129T probably benign Het
Efcab3 T C 11: 104,601,503 (GRCm39) V272A probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fat1 T C 8: 45,479,899 (GRCm39) F2982L probably benign Het
Gm9476 A T 10: 100,142,700 (GRCm39) noncoding transcript Het
Golga1 A G 2: 38,913,261 (GRCm39) M542T probably benign Het
H2-D1 T A 17: 35,482,844 (GRCm39) C125S probably damaging Het
Jazf1 G A 6: 52,789,166 (GRCm39) H103Y probably damaging Het
Klhl12 T C 1: 134,416,712 (GRCm39) V478A possibly damaging Het
Lpcat2b A T 5: 107,581,330 (GRCm39) T220S probably damaging Het
Myocd C T 11: 65,075,342 (GRCm39) C594Y probably damaging Het
Nf1 A G 11: 79,331,735 (GRCm39) E700G probably damaging Het
Or52z15 T C 7: 103,332,678 (GRCm39) V251A possibly damaging Het
Or6k2 T A 1: 173,986,930 (GRCm39) M197K possibly damaging Het
Papln A G 12: 83,829,690 (GRCm39) Q937R probably damaging Het
Pex14 T C 4: 149,052,029 (GRCm39) R147G probably damaging Het
Plppr3 A T 10: 79,703,374 (GRCm39) Y37N probably damaging Het
Polr1b A G 2: 128,955,654 (GRCm39) T522A probably benign Het
Ppp3cb T C 14: 20,574,492 (GRCm39) N201S probably damaging Het
Prf1 A G 10: 61,139,329 (GRCm39) D429G probably damaging Het
Rp1l1 C T 14: 64,268,341 (GRCm39) T1309I possibly damaging Het
Sipa1l1 T A 12: 82,487,667 (GRCm39) M1647K probably damaging Het
Skint11 T C 4: 114,088,963 (GRCm39) probably null Het
Slc8a2 T C 7: 15,874,522 (GRCm39) Y257H probably benign Het
Slfn1 T A 11: 83,012,181 (GRCm39) I99N probably damaging Het
Slit2 A G 5: 48,349,591 (GRCm39) T282A probably damaging Het
Slit3 A T 11: 35,461,448 (GRCm39) D228V probably damaging Het
Specc1l A G 10: 75,143,072 (GRCm39) N1031S probably benign Het
Supt6 A G 11: 78,107,029 (GRCm39) probably null Het
Tdrd1 G A 19: 56,839,790 (GRCm39) E617K probably damaging Het
Tex15 C G 8: 34,066,880 (GRCm39) F2103L probably damaging Het
Trim21 T A 7: 102,208,783 (GRCm39) Q312L possibly damaging Het
Trim56 C T 5: 137,142,791 (GRCm39) A242T probably benign Het
Usp4 T C 9: 108,249,873 (GRCm39) V467A probably benign Het
Vmn2r65 T A 7: 84,589,886 (GRCm39) I677L probably benign Het
Vstm4 T C 14: 32,585,511 (GRCm39) V26A probably damaging Het
Zbtb14 C G 17: 69,694,759 (GRCm39) I152M probably benign Het
Zfat T A 15: 68,050,600 (GRCm39) K807I probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116,544,048 (GRCm39) missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAACTGATCCCTTGACTGTGCC -3'
(R):5'- GCAACACCGCTTTCAACTCGTC -3'

Sequencing Primer
(F):5'- CTTGACTGTGCCTATGGTTGTC -3'
(R):5'- CAGTGGTGAACACACCTTTTG -3'
Posted On 2014-04-13