Incidental Mutation 'R1509:Dis3l2'
ID 168106
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene Name DIS3 like 3'-5' exoribonuclease 2
Synonyms 8030493P09Rik, 4930429A22Rik
MMRRC Submission 039556-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.357) question?
Stock # R1509 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 86631530-86977817 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86948808 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 582 (C582S)
Ref Sequence ENSEMBL: ENSMUSP00000132673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
AlphaFold Q8CI75
Predicted Effect probably benign
Transcript: ENSMUST00000065694
AA Change: C568S

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: C568S

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168237
AA Change: C582S

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: C582S

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185304
Predicted Effect probably benign
Transcript: ENSMUST00000190618
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Meta Mutation Damage Score 0.2266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,340,766 (GRCm39) S132P probably benign Het
AC153895.1 T C 6: 50,020,451 (GRCm39) R54G unknown Het
Acot12 G A 13: 91,919,994 (GRCm39) probably null Het
Adhfe1 T A 1: 9,623,671 (GRCm39) D98E probably benign Het
Ago2 A G 15: 72,988,213 (GRCm39) F594S probably damaging Het
Aldh18a1 A G 19: 40,545,927 (GRCm39) I620T probably damaging Het
Aspscr1 C A 11: 120,592,342 (GRCm39) A294D probably damaging Het
Bod1l C G 5: 41,976,883 (GRCm39) R1477T probably damaging Het
Ccdc18 C A 5: 108,336,844 (GRCm39) A741D possibly damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Cfap52 C T 11: 67,829,819 (GRCm39) V317I probably benign Het
Cgn A T 3: 94,681,568 (GRCm39) L509Q probably benign Het
Crb2 A G 2: 37,676,631 (GRCm39) H204R probably benign Het
Cspg4b A G 13: 113,504,790 (GRCm39) N431S probably damaging Het
Ddx39a G A 8: 84,446,527 (GRCm39) V99M probably damaging Het
Dmbt1 G A 7: 130,676,061 (GRCm39) probably benign Het
Dnah6 T C 6: 73,004,425 (GRCm39) E3846G probably damaging Het
Dstyk A G 1: 132,384,084 (GRCm39) E655G probably damaging Het
Epha4 T C 1: 77,357,523 (GRCm39) Y825C probably damaging Het
Esp36 T A 17: 38,728,173 (GRCm39) N36I probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fem1c A G 18: 46,657,280 (GRCm39) S145P probably benign Het
Galnt13 T C 2: 54,623,094 (GRCm39) I80T probably damaging Het
Gm5698 T C 1: 31,016,728 (GRCm39) T108A probably benign Het
Hipk3 A G 2: 104,271,607 (GRCm39) S442P probably benign Het
Hmcn2 T A 2: 31,204,491 (GRCm39) V22D possibly damaging Het
Hspg2 C T 4: 137,238,552 (GRCm39) probably benign Het
Ide A G 19: 37,262,603 (GRCm39) probably null Het
Ifnar1 C A 16: 91,300,384 (GRCm39) P462Q probably damaging Het
Itgb2l T A 16: 96,228,049 (GRCm39) I485F probably benign Het
Jakmip3 C T 7: 138,629,505 (GRCm39) R549W possibly damaging Het
Lrrc36 A G 8: 106,187,761 (GRCm39) Q680R probably damaging Het
Lysmd3 T G 13: 81,817,390 (GRCm39) H122Q probably benign Het
Macf1 C A 4: 123,577,802 (GRCm39) V61L possibly damaging Het
Map1b T C 13: 99,568,036 (GRCm39) T1562A unknown Het
Map3k20 A T 2: 72,194,968 (GRCm39) probably benign Het
Mroh8 A G 2: 157,075,125 (GRCm39) V457A probably benign Het
Mrpl40 T A 16: 18,694,159 (GRCm39) probably null Het
Ms4a10 C T 19: 10,941,472 (GRCm39) V166I probably benign Het
Mycl A G 4: 122,894,100 (GRCm39) D300G probably damaging Het
Naca T A 10: 127,879,266 (GRCm39) probably benign Het
Ncoa4 T C 14: 31,895,391 (GRCm39) S172P probably damaging Het
Nfatc3 T C 8: 106,810,486 (GRCm39) F421L possibly damaging Het
Nucb1 C A 7: 45,144,649 (GRCm39) K301N probably benign Het
Or1af1 A G 2: 37,109,966 (GRCm39) H155R probably damaging Het
Or52ae9 A T 7: 103,390,243 (GRCm39) M68K probably benign Het
Or5b99 T A 19: 12,976,815 (GRCm39) I155N possibly damaging Het
Panx1 A T 9: 14,921,341 (GRCm39) V178E possibly damaging Het
Pkd1l3 G A 8: 110,367,402 (GRCm39) V1210I probably damaging Het
Polr2a A T 11: 69,638,039 (GRCm39) H143Q possibly damaging Het
Potefam1 A T 2: 111,048,972 (GRCm39) M269K probably benign Het
Prdm12 G A 2: 31,544,186 (GRCm39) R263H probably damaging Het
Prkdc A C 16: 15,549,430 (GRCm39) K1998T probably damaging Het
Rab11fip1 A T 8: 27,643,051 (GRCm39) S583T probably damaging Het
Rnf157 T A 11: 116,237,921 (GRCm39) T567S probably benign Het
Rp1 T C 1: 4,417,917 (GRCm39) K1065R probably damaging Het
Rp1 A G 1: 4,418,760 (GRCm39) I784T probably benign Het
Rps10 A C 17: 27,850,182 (GRCm39) F150V probably benign Het
Rrp12 A T 19: 41,870,639 (GRCm39) F499I probably damaging Het
Sez6l2 G A 7: 126,562,535 (GRCm39) R604H probably damaging Het
Slc25a21 G T 12: 56,904,864 (GRCm39) Q57K probably benign Het
Slc27a2 A G 2: 126,395,234 (GRCm39) T54A possibly damaging Het
Slc9a9 T A 9: 95,111,011 (GRCm39) S610T probably benign Het
Smc1b A T 15: 84,970,335 (GRCm39) S973T probably benign Het
Smc6 G A 12: 11,329,734 (GRCm39) S164N possibly damaging Het
Sp1 A G 15: 102,316,314 (GRCm39) T32A possibly damaging Het
Spen T C 4: 141,202,946 (GRCm39) I1894V probably benign Het
Spen T C 4: 141,203,011 (GRCm39) K1872R possibly damaging Het
Stab1 C A 14: 30,873,541 (GRCm39) probably benign Het
Taar7d T G 10: 23,904,102 (GRCm39) F328C probably damaging Het
Ticam1 A T 17: 56,578,113 (GRCm39) S327R probably benign Het
Tmem248 C T 5: 130,258,295 (GRCm39) probably benign Het
Tom1 T C 8: 75,781,259 (GRCm39) S83P probably damaging Het
Txk T A 5: 72,856,453 (GRCm39) Y446F probably damaging Het
Ubap1l T A 9: 65,279,237 (GRCm39) C179S probably benign Het
Utrn T C 10: 12,331,185 (GRCm39) E474G possibly damaging Het
Vmn2r14 T C 5: 109,363,862 (GRCm39) M685V probably benign Het
Vmn2r7 A T 3: 64,623,881 (GRCm39) Y146* probably null Het
Wdr1 G A 5: 38,697,905 (GRCm39) T220M probably damaging Het
Xpo7 T C 14: 70,915,582 (GRCm39) D726G probably damaging Het
Zbtb14 C G 17: 69,694,759 (GRCm39) I152M probably benign Het
Zbtb3 A G 19: 8,780,771 (GRCm39) D128G probably damaging Het
Zeb1os1 A G 18: 5,583,794 (GRCm39) noncoding transcript Het
Zfp462 T A 4: 55,007,667 (GRCm39) D35E probably damaging Het
Zfp467 A G 6: 48,415,621 (GRCm39) S344P possibly damaging Het
Zfpm1 A T 8: 123,034,285 (GRCm39) D73V possibly damaging Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86,784,925 (GRCm39) missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86,673,209 (GRCm39) missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86,917,953 (GRCm39) missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 86,976,551 (GRCm39) splice site probably benign
R0514:Dis3l2 UTSW 1 86,974,814 (GRCm39) missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 86,971,928 (GRCm39) splice site probably null
R1086:Dis3l2 UTSW 1 86,917,871 (GRCm39) missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86,749,160 (GRCm39) missense probably benign 0.00
R2029:Dis3l2 UTSW 1 86,782,189 (GRCm39) splice site probably benign
R2511:Dis3l2 UTSW 1 86,917,980 (GRCm39) missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86,782,130 (GRCm39) missense probably benign
R4163:Dis3l2 UTSW 1 86,748,959 (GRCm39) missense probably benign 0.00
R4547:Dis3l2 UTSW 1 86,977,393 (GRCm39) missense probably benign 0.00
R4548:Dis3l2 UTSW 1 86,977,393 (GRCm39) missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86,918,043 (GRCm39) missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 86,975,296 (GRCm39) missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 86,971,890 (GRCm39) missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86,688,043 (GRCm39) missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86,785,059 (GRCm39) missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86,901,126 (GRCm39) missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 86,948,841 (GRCm39) critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86,901,126 (GRCm39) missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86,806,154 (GRCm39) missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 86,977,360 (GRCm39) missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 86,948,830 (GRCm39) missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86,782,153 (GRCm39) missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86,673,216 (GRCm39) missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86,673,216 (GRCm39) missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 86,972,561 (GRCm39) missense probably benign 0.00
R6921:Dis3l2 UTSW 1 86,785,063 (GRCm39) missense probably benign
R7162:Dis3l2 UTSW 1 86,971,752 (GRCm39) missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86,918,025 (GRCm39) missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86,673,222 (GRCm39) critical splice donor site probably null
R8422:Dis3l2 UTSW 1 86,782,099 (GRCm39) missense probably benign
R8696:Dis3l2 UTSW 1 86,719,162 (GRCm39) nonsense probably null
R9235:Dis3l2 UTSW 1 86,749,061 (GRCm39) missense possibly damaging 0.95
R9291:Dis3l2 UTSW 1 86,901,215 (GRCm39) missense possibly damaging 0.82
R9629:Dis3l2 UTSW 1 86,974,784 (GRCm39) missense probably benign 0.00
X0027:Dis3l2 UTSW 1 86,688,073 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTGGCGTTTCCACAGCACATC -3'
(R):5'- ACCTTCCACAGTGTTTGGCACAG -3'

Sequencing Primer
(F):5'- GTTTCCACAGCACATCCACTG -3'
(R):5'- ctctcttctctctttctcacatttc -3'
Posted On 2014-04-13