Mutagenetix > Incidental Mutation

Incidental Mutation 'R1509:Dnah6'

168135

Institutional Source

Beutler Lab

Gene Symbol

Dnah6

Ensembl Gene

ENSMUSG00000052861

Gene Name

dynein, axonemal, heavy chain 6

Synonyms

A730004I20Rik, Dnahc6

MMRRC Submission

039556-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R1509 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73017606-73221651 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73027442 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 3846 (E3846G)

Ref Sequence

ENSEMBL: ENSMUSP00000144791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000064948
AA Change: E3846G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: E3846G

Domain	Start	End	E-Value	Type
coiled coil region	732	759	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
Pfam:DHC_N2	875	1298	4.3e-144	PFAM
AAA	1459	1562	2.76e-1	SMART
AAA	1740	1881	5.25e-1	SMART
low complexity region	1957	1967	N/A	INTRINSIC
AAA	2083	2236	1.01e-3	SMART
AAA	2434	2592	3.08e0	SMART
low complexity region	2607	2618	N/A	INTRINSIC
low complexity region	2645	2656	N/A	INTRINSIC
Pfam:MT	2685	3019	3.1e-53	PFAM
Pfam:AAA_9	3040	3265	3.6e-94	PFAM
Pfam:Dynein_heavy	3402	4140	1.2e-250	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114040
AA Change: E3794G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: E3794G

Domain	Start	End	E-Value	Type
coiled coil region	732	759	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
Pfam:DHC_N2	873	1300	2.2e-135	PFAM
AAA	1407	1510	2.76e-1	SMART
AAA	1688	1829	5.25e-1	SMART
low complexity region	1905	1915	N/A	INTRINSIC
AAA	2031	2184	1.01e-3	SMART
AAA	2382	2540	3.08e0	SMART
low complexity region	2555	2566	N/A	INTRINSIC
low complexity region	2593	2604	N/A	INTRINSIC
Pfam:MT	2633	2967	1.1e-53	PFAM
Pfam:AAA_9	2984	3214	1e-58	PFAM
Pfam:Dynein_heavy	3344	4089	2.2e-213	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204053
AA Change: E3846G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: E3846G

Domain	Start	End	E-Value	Type
coiled coil region	732	759	N/A	INTRINSIC
low complexity region	841	852	N/A	INTRINSIC
Pfam:DHC_N2	875	1298	4.3e-144	PFAM
AAA	1459	1562	2.76e-1	SMART
AAA	1740	1881	5.25e-1	SMART
low complexity region	1957	1967	N/A	INTRINSIC
AAA	2083	2236	1.01e-3	SMART
AAA	2434	2592	3.08e0	SMART
low complexity region	2607	2618	N/A	INTRINSIC
low complexity region	2645	2656	N/A	INTRINSIC
Pfam:MT	2685	3019	3.1e-53	PFAM
Pfam:AAA_9	3040	3265	3.6e-94	PFAM
Pfam:Dynein_heavy	3402	4140	1.2e-250	PFAM

Meta Mutation Damage Score

0.4752

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,192,647	S132P	probably benign	Het
4930430A15Rik	A	T	2: 111,218,627	M269K	probably benign	Het
AC153895.1	T	C	6: 50,043,471	R54G	unknown	Het
Acot12	G	A	13: 91,771,875		probably null	Het
Adhfe1	T	A	1: 9,553,446	D98E	probably benign	Het
Ago2	A	G	15: 73,116,364	F594S	probably damaging	Het
Aldh18a1	A	G	19: 40,557,483	I620T	probably damaging	Het
Aspscr1	C	A	11: 120,701,516	A294D	probably damaging	Het
BC067074	A	G	13: 113,368,256	N431S	probably damaging	Het
Bod1l	C	G	5: 41,819,540	R1477T	probably damaging	Het
Ccdc18	C	A	5: 108,188,978	A741D	possibly damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap52	C	T	11: 67,938,993	V317I	probably benign	Het
Cgn	A	T	3: 94,774,258	L509Q	probably benign	Het
Crb2	A	G	2: 37,786,619	H204R	probably benign	Het
Ddx39	G	A	8: 83,719,898	V99M	probably damaging	Het
Dis3l2	T	A	1: 87,021,086	C582S	possibly damaging	Het
Dmbt1	G	A	7: 131,074,331		probably benign	Het
Dstyk	A	G	1: 132,456,346	E655G	probably damaging	Het
Epha4	T	C	1: 77,380,886	Y825C	probably damaging	Het
Esp36	T	A	17: 38,417,282	N36I	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fem1c	A	G	18: 46,524,213	S145P	probably benign	Het
Galnt13	T	C	2: 54,733,082	I80T	probably damaging	Het
Gm10125	A	G	18: 5,583,794		noncoding transcript	Het
Gm5698	T	C	1: 30,977,647	T108A	probably benign	Het
Hipk3	A	G	2: 104,441,262	S442P	probably benign	Het
Hmcn2	T	A	2: 31,314,479	V22D	possibly damaging	Het
Hspg2	C	T	4: 137,511,241		probably benign	Het
Ide	A	G	19: 37,285,204		probably null	Het
Ifnar1	C	A	16: 91,503,496	P462Q	probably damaging	Het
Itgb2l	T	A	16: 96,426,849	I485F	probably benign	Het
Jakmip3	C	T	7: 139,027,776	R549W	possibly damaging	Het
Lrrc36	A	G	8: 105,461,129	Q680R	probably damaging	Het
Lysmd3	T	G	13: 81,669,271	H122Q	probably benign	Het
Macf1	C	A	4: 123,684,009	V61L	possibly damaging	Het
Map1b	T	C	13: 99,431,528	T1562A	unknown	Het
Map3k20	A	T	2: 72,364,624		probably benign	Het
Mroh8	A	G	2: 157,233,205	V457A	probably benign	Het
Mrpl40	T	A	16: 18,875,409		probably null	Het
Ms4a10	C	T	19: 10,964,108	V166I	probably benign	Het
Mycl	A	G	4: 123,000,307	D300G	probably damaging	Het
Naca	T	A	10: 128,043,397		probably benign	Het
Ncoa4	T	C	14: 32,173,434	S172P	probably damaging	Het
Nfatc3	T	C	8: 106,083,854	F421L	possibly damaging	Het
Nucb1	C	A	7: 45,495,225	K301N	probably benign	Het
Olfr1451	T	A	19: 12,999,451	I155N	possibly damaging	Het
Olfr366	A	G	2: 37,219,954	H155R	probably damaging	Het
Olfr629	A	T	7: 103,741,036	M68K	probably benign	Het
Panx1	A	T	9: 15,010,045	V178E	possibly damaging	Het
Pkd1l3	G	A	8: 109,640,770	V1210I	probably damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Prdm12	G	A	2: 31,654,174	R263H	probably damaging	Het
Prkdc	A	C	16: 15,731,566	K1998T	probably damaging	Het
Rab11fip1	A	T	8: 27,153,023	S583T	probably damaging	Het
Rnf157	T	A	11: 116,347,095	T567S	probably benign	Het
Rp1	T	C	1: 4,347,694	K1065R	probably damaging	Het
Rp1	A	G	1: 4,348,537	I784T	probably benign	Het
Rps10	A	C	17: 27,631,208	F150V	probably benign	Het
Rrp12	A	T	19: 41,882,200	F499I	probably damaging	Het
Sez6l2	G	A	7: 126,963,363	R604H	probably damaging	Het
Slc25a21	G	T	12: 56,858,079	Q57K	probably benign	Het
Slc27a2	A	G	2: 126,553,314	T54A	possibly damaging	Het
Slc9a9	T	A	9: 95,228,958	S610T	probably benign	Het
Smc1b	A	T	15: 85,086,134	S973T	probably benign	Het
Smc6	G	A	12: 11,279,733	S164N	possibly damaging	Het
Sp1	A	G	15: 102,407,879	T32A	possibly damaging	Het
Spen	T	C	4: 141,475,635	I1894V	probably benign	Het
Spen	T	C	4: 141,475,700	K1872R	possibly damaging	Het
Stab1	C	A	14: 31,151,584		probably benign	Het
Taar7d	T	G	10: 24,028,204	F328C	probably damaging	Het
Ticam1	A	T	17: 56,271,113	S327R	probably benign	Het
Tmem248	C	T	5: 130,229,454		probably benign	Het
Tom1	T	C	8: 75,054,631	S83P	probably damaging	Het
Txk	T	A	5: 72,699,110	Y446F	probably damaging	Het
Ubap1l	T	A	9: 65,371,955	C179S	probably benign	Het
Utrn	T	C	10: 12,455,441	E474G	possibly damaging	Het
Vmn2r14	T	C	5: 109,215,996	M685V	probably benign	Het
Vmn2r7	A	T	3: 64,716,460	Y146*	probably null	Het
Wdr1	G	A	5: 38,540,562	T220M	probably damaging	Het
Xpo7	T	C	14: 70,678,142	D726G	probably damaging	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het
Zbtb3	A	G	19: 8,803,407	D128G	probably damaging	Het
Zfp462	T	A	4: 55,007,667	D35E	probably damaging	Het
Zfp467	A	G	6: 48,438,687	S344P	possibly damaging	Het
Zfpm1	A	T	8: 122,307,546	D73V	possibly damaging	Het

Other mutations in Dnah6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Dnah6	APN	6	73195737	missense	probably benign	0.00
IGL00488:Dnah6	APN	6	73086207	missense	possibly damaging	0.95
IGL00497:Dnah6	APN	6	73195761	missense	probably damaging	1.00
IGL00557:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00561:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00563:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00755:Dnah6	APN	6	73212434	critical splice donor site	probably null
IGL00756:Dnah6	APN	6	73123771	missense	possibly damaging	0.76
IGL00764:Dnah6	APN	6	73195620	missense	possibly damaging	0.47
IGL00895:Dnah6	APN	6	73156350	missense	possibly damaging	0.67
IGL00922:Dnah6	APN	6	73033526	splice site	probably benign
IGL00972:Dnah6	APN	6	73083157	splice site	probably benign
IGL00975:Dnah6	APN	6	73173390	missense	possibly damaging	0.94
IGL01014:Dnah6	APN	6	73074781	splice site	probably benign
IGL01307:Dnah6	APN	6	73065725	missense	probably damaging	1.00
IGL01353:Dnah6	APN	6	73173456	missense	probably benign	0.01
IGL01362:Dnah6	APN	6	73092178	missense	probably damaging	1.00
IGL01373:Dnah6	APN	6	73074748	missense	probably benign	0.10
IGL01559:Dnah6	APN	6	73024252	critical splice donor site	probably null
IGL01622:Dnah6	APN	6	73144718	missense	probably damaging	1.00
IGL01623:Dnah6	APN	6	73144718	missense	probably damaging	1.00
IGL01682:Dnah6	APN	6	73075802	missense	probably damaging	1.00
IGL01735:Dnah6	APN	6	73076660	nonsense	probably null
IGL01736:Dnah6	APN	6	73188377	missense	probably benign	0.06
IGL01825:Dnah6	APN	6	73065776	missense	probably damaging	1.00
IGL01835:Dnah6	APN	6	73135801	missense	probably damaging	1.00
IGL01870:Dnah6	APN	6	73032569	missense	probably benign	0.04
IGL01935:Dnah6	APN	6	73060143	missense	probably benign
IGL02126:Dnah6	APN	6	73103166	missense	probably benign	0.01
IGL02191:Dnah6	APN	6	73017797	missense	probably benign	0.00
IGL02293:Dnah6	APN	6	73133650	splice site	probably benign
IGL02316:Dnah6	APN	6	73168911	missense	probably benign	0.19
IGL02339:Dnah6	APN	6	73101898	missense	probably benign	0.00
IGL02380:Dnah6	APN	6	73076640	missense	probably benign	0.12
IGL02458:Dnah6	APN	6	73027448	missense	probably benign	0.43
IGL02499:Dnah6	APN	6	73021227	missense	probably benign	0.12
IGL02652:Dnah6	APN	6	73095104	missense	probably damaging	1.00
IGL02668:Dnah6	APN	6	73121823	missense	possibly damaging	0.61
IGL02858:Dnah6	APN	6	73208599	missense	probably benign	0.03
IGL02875:Dnah6	APN	6	73138715	missense	probably damaging	0.99
IGL02878:Dnah6	APN	6	73032587	missense	probably benign	0.01
IGL02989:Dnah6	APN	6	73069420	missense	probably damaging	1.00
IGL03001:Dnah6	APN	6	73149140	missense	probably benign	0.19
IGL03135:Dnah6	APN	6	73145004	missense	probably benign	0.00
IGL03145:Dnah6	APN	6	73041054	missense	probably damaging	1.00
IGL03202:Dnah6	APN	6	73144700	missense	probably damaging	1.00
IGL03282:Dnah6	APN	6	73053647	splice site	probably benign
IGL03286:Dnah6	APN	6	73083085	missense	probably damaging	1.00
IGL03372:Dnah6	APN	6	73075850	missense	probably benign	0.15
P0025:Dnah6	UTSW	6	73163504	missense	probably benign	0.00
PIT4305001:Dnah6	UTSW	6	73065755	missense	probably benign	0.03
PIT4466001:Dnah6	UTSW	6	73208641	missense	probably benign	0.00
PIT4480001:Dnah6	UTSW	6	73101880	missense	probably benign	0.00
PIT4515001:Dnah6	UTSW	6	73114582	missense	probably damaging	1.00
PIT4651001:Dnah6	UTSW	6	73060260	missense	probably benign	0.02
R0103:Dnah6	UTSW	6	73092172	missense	probably damaging	1.00
R0103:Dnah6	UTSW	6	73092172	missense	probably damaging	1.00
R0105:Dnah6	UTSW	6	73155279	missense	probably damaging	0.99
R0105:Dnah6	UTSW	6	73155279	missense	probably damaging	0.99
R0127:Dnah6	UTSW	6	73038734	splice site	probably benign
R0164:Dnah6	UTSW	6	73188535	splice site	probably benign
R0165:Dnah6	UTSW	6	73021323	missense	probably benign	0.01
R0183:Dnah6	UTSW	6	73082923	missense	probably damaging	1.00
R0200:Dnah6	UTSW	6	73069420	missense	probably damaging	1.00
R0304:Dnah6	UTSW	6	73159115	missense	probably damaging	1.00
R0324:Dnah6	UTSW	6	73173558	missense	possibly damaging	0.86
R0335:Dnah6	UTSW	6	73069399	splice site	probably benign
R0345:Dnah6	UTSW	6	73021257	missense	probably benign	0.12
R0357:Dnah6	UTSW	6	73188359	missense	probably benign
R0362:Dnah6	UTSW	6	73208609	missense	probably benign	0.06
R0377:Dnah6	UTSW	6	73121992	missense	possibly damaging	0.93
R0386:Dnah6	UTSW	6	73083124	missense	probably damaging	0.99
R0547:Dnah6	UTSW	6	73044774	missense	probably benign	0.15
R0639:Dnah6	UTSW	6	73022412	missense	probably benign	0.02
R0673:Dnah6	UTSW	6	73123811	missense	probably benign	0.01
R0690:Dnah6	UTSW	6	73129474	missense	probably benign	0.01
R0708:Dnah6	UTSW	6	73212622	missense	probably benign	0.05
R0711:Dnah6	UTSW	6	73087602	missense	probably damaging	0.99
R0718:Dnah6	UTSW	6	73035293	missense	possibly damaging	0.80
R0894:Dnah6	UTSW	6	73124757	missense	probably benign	0.00
R0972:Dnah6	UTSW	6	73159193	missense	possibly damaging	0.94
R1263:Dnah6	UTSW	6	73144965	missense	probably damaging	0.99
R1298:Dnah6	UTSW	6	73159135	missense	probably damaging	1.00
R1300:Dnah6	UTSW	6	73124709	missense	probably benign	0.22
R1301:Dnah6	UTSW	6	73208545	critical splice donor site	probably null
R1341:Dnah6	UTSW	6	73191619	missense	probably benign	0.09
R1519:Dnah6	UTSW	6	73049048	missense	probably damaging	0.97
R1533:Dnah6	UTSW	6	73151553	missense	probably benign
R1557:Dnah6	UTSW	6	73049131	nonsense	probably null
R1591:Dnah6	UTSW	6	73076600	missense	probably benign	0.01
R1602:Dnah6	UTSW	6	73067469	missense	probably damaging	1.00
R1610:Dnah6	UTSW	6	73144963	missense	probably benign	0.09
R1616:Dnah6	UTSW	6	73100112	missense	probably benign	0.10
R1643:Dnah6	UTSW	6	73044752	missense	possibly damaging	0.85
R1644:Dnah6	UTSW	6	73155296	missense	probably benign	0.18
R1655:Dnah6	UTSW	6	73205732	missense	possibly damaging	0.88
R1661:Dnah6	UTSW	6	73124778	missense	probably benign	0.00
R1665:Dnah6	UTSW	6	73124778	missense	probably benign	0.00
R1675:Dnah6	UTSW	6	73129540	missense	probably damaging	1.00
R1734:Dnah6	UTSW	6	73044761	missense	probably damaging	0.98
R1757:Dnah6	UTSW	6	73160982	missense	probably damaging	1.00
R1794:Dnah6	UTSW	6	73024958	missense	probably damaging	0.99
R1831:Dnah6	UTSW	6	73181797	missense	possibly damaging	0.76
R1866:Dnah6	UTSW	6	73100088	missense	probably benign	0.00
R1897:Dnah6	UTSW	6	73181762	missense	probably benign	0.30
R1951:Dnah6	UTSW	6	73084721	nonsense	probably null
R1978:Dnah6	UTSW	6	73121970	missense	possibly damaging	0.51
R1987:Dnah6	UTSW	6	73095044	missense	probably damaging	0.96
R1988:Dnah6	UTSW	6	73092192	missense	probably damaging	1.00
R2012:Dnah6	UTSW	6	73067466	missense	probably damaging	1.00
R2014:Dnah6	UTSW	6	73173419	missense	probably damaging	0.98
R2022:Dnah6	UTSW	6	73027422	missense	probably benign
R2041:Dnah6	UTSW	6	73073439	missense	probably damaging	1.00
R2068:Dnah6	UTSW	6	73021182	missense	probably benign	0.23
R2114:Dnah6	UTSW	6	73144035	missense	probably damaging	1.00
R2152:Dnah6	UTSW	6	73049166	missense	probably benign	0.32
R2163:Dnah6	UTSW	6	73089746	splice site	probably null
R2193:Dnah6	UTSW	6	73138640	missense	probably damaging	1.00
R2235:Dnah6	UTSW	6	73100085	missense	probably damaging	0.96
R2276:Dnah6	UTSW	6	73113581	missense	probably benign	0.15
R2292:Dnah6	UTSW	6	73021109	missense	probably damaging	1.00
R2355:Dnah6	UTSW	6	73156421	missense	possibly damaging	0.95
R2395:Dnah6	UTSW	6	73091967	splice site	probably null
R2436:Dnah6	UTSW	6	73149173	missense	probably benign	0.05
R2847:Dnah6	UTSW	6	73129331	missense	probably benign	0.41
R2848:Dnah6	UTSW	6	73129331	missense	probably benign	0.41
R3033:Dnah6	UTSW	6	73173350	missense	probably benign	0.03
R3429:Dnah6	UTSW	6	73121814	missense	possibly damaging	0.95
R3430:Dnah6	UTSW	6	73121814	missense	possibly damaging	0.95
R3499:Dnah6	UTSW	6	73032633	missense	probably benign	0.21
R3811:Dnah6	UTSW	6	73191498	missense	probably benign	0.00
R3852:Dnah6	UTSW	6	73127927	missense	possibly damaging	0.82
R3975:Dnah6	UTSW	6	73121992	missense	possibly damaging	0.93
R4164:Dnah6	UTSW	6	73089592	nonsense	probably null
R4246:Dnah6	UTSW	6	73129448	missense	probably benign	0.00
R4367:Dnah6	UTSW	6	73149484	missense	possibly damaging	0.95
R4378:Dnah6	UTSW	6	73118026	missense	probably benign	0.01
R4405:Dnah6	UTSW	6	73129291	missense	probably benign	0.00
R4420:Dnah6	UTSW	6	73191479	missense	probably benign
R4486:Dnah6	UTSW	6	73038746	missense	probably damaging	1.00
R4512:Dnah6	UTSW	6	73178416	missense	probably damaging	1.00
R4547:Dnah6	UTSW	6	73192405	missense	probably benign
R4573:Dnah6	UTSW	6	73086181	missense	probably damaging	1.00
R4574:Dnah6	UTSW	6	73086181	missense	probably damaging	1.00
R4590:Dnah6	UTSW	6	73152712	missense	probably damaging	0.99
R4604:Dnah6	UTSW	6	73129660	missense	possibly damaging	0.92
R4652:Dnah6	UTSW	6	73070597	missense	probably benign
R4653:Dnah6	UTSW	6	73073457	missense	possibly damaging	0.76
R4669:Dnah6	UTSW	6	73037688	missense	probably damaging	1.00
R4674:Dnah6	UTSW	6	73192422	missense	probably benign	0.04
R4712:Dnah6	UTSW	6	73025012	critical splice acceptor site	probably null
R4788:Dnah6	UTSW	6	73129530	missense	probably damaging	1.00
R4791:Dnah6	UTSW	6	73095074	missense	probably benign	0.11
R4792:Dnah6	UTSW	6	73089668	missense	probably damaging	0.99
R4801:Dnah6	UTSW	6	73089698	missense	probably damaging	1.00
R4802:Dnah6	UTSW	6	73089698	missense	probably damaging	1.00
R4817:Dnah6	UTSW	6	73022424	missense	probably benign	0.02
R4830:Dnah6	UTSW	6	73044762	missense	possibly damaging	0.85
R4862:Dnah6	UTSW	6	73121788	missense	probably damaging	0.99
R4916:Dnah6	UTSW	6	73192676	intron	probably benign
R4948:Dnah6	UTSW	6	73053689	missense	probably benign	0.00
R4953:Dnah6	UTSW	6	73188383	missense	probably benign	0.19
R5000:Dnah6	UTSW	6	73144815	missense	probably benign	0.26
R5036:Dnah6	UTSW	6	73044691	missense	probably benign
R5044:Dnah6	UTSW	6	73037622	missense	probably benign	0.41
R5143:Dnah6	UTSW	6	73181761	missense	possibly damaging	0.91
R5157:Dnah6	UTSW	6	73195634	missense	probably benign
R5186:Dnah6	UTSW	6	73067427	missense	probably damaging	1.00
R5201:Dnah6	UTSW	6	73195732	missense	possibly damaging	0.82
R5249:Dnah6	UTSW	6	73113488	missense	probably damaging	1.00
R5272:Dnah6	UTSW	6	73127861	critical splice donor site	probably null
R5330:Dnah6	UTSW	6	73074590	missense	probably damaging	1.00
R5331:Dnah6	UTSW	6	73074590	missense	probably damaging	1.00
R5340:Dnah6	UTSW	6	73212620	missense	probably benign
R5343:Dnah6	UTSW	6	73212616	missense	probably benign
R5375:Dnah6	UTSW	6	73123855	missense	probably damaging	1.00
R5380:Dnah6	UTSW	6	73037615	missense	probably damaging	1.00
R5435:Dnah6	UTSW	6	73060138	missense	probably benign	0.00
R5455:Dnah6	UTSW	6	73075734	missense	probably benign	0.00
R5458:Dnah6	UTSW	6	73086185	missense	probably damaging	1.00
R5463:Dnah6	UTSW	6	73092157	missense	probably benign	0.04
R5484:Dnah6	UTSW	6	73092116	missense	possibly damaging	0.95
R5513:Dnah6	UTSW	6	73190419	missense	probably null	0.00
R5527:Dnah6	UTSW	6	73159229	missense	probably benign
R5541:Dnah6	UTSW	6	73192988	missense	possibly damaging	0.91
R5548:Dnah6	UTSW	6	73151689	missense	probably damaging	1.00
R5680:Dnah6	UTSW	6	73149525	missense	probably damaging	1.00
R5689:Dnah6	UTSW	6	73021227	missense	probably benign	0.12
R5966:Dnah6	UTSW	6	73060279	missense	probably benign	0.00
R5980:Dnah6	UTSW	6	73181722	missense	probably benign	0.01
R6049:Dnah6	UTSW	6	73086166	missense	probably benign	0.38
R6092:Dnah6	UTSW	6	73114697	missense	possibly damaging	0.61
R6130:Dnah6	UTSW	6	73188494	missense	probably benign	0.16
R6279:Dnah6	UTSW	6	73065815	missense	probably damaging	1.00
R6300:Dnah6	UTSW	6	73065815	missense	probably damaging	1.00
R6301:Dnah6	UTSW	6	73086217	missense	probably damaging	1.00
R6315:Dnah6	UTSW	6	73191605	missense	probably benign	0.02
R6394:Dnah6	UTSW	6	73155418	nonsense	probably null
R6470:Dnah6	UTSW	6	73074586	missense	probably damaging	1.00
R6526:Dnah6	UTSW	6	73074704	missense	probably benign	0.05
R6545:Dnah6	UTSW	6	73044732	missense	probably damaging	1.00
R6583:Dnah6	UTSW	6	73173533	missense	probably benign	0.02
R6609:Dnah6	UTSW	6	73053695	missense	possibly damaging	0.52
R6638:Dnah6	UTSW	6	73035280	splice site	probably null
R6640:Dnah6	UTSW	6	73024293	missense	probably damaging	1.00
R6647:Dnah6	UTSW	6	73138760	missense	probably damaging	1.00
R6744:Dnah6	UTSW	6	73037549	missense	probably damaging	0.97
R6767:Dnah6	UTSW	6	73133608	missense	probably benign	0.29
R6845:Dnah6	UTSW	6	73133542	missense	probably damaging	1.00
R6913:Dnah6	UTSW	6	73212522	missense	probably benign	0.00
R6918:Dnah6	UTSW	6	73181755	nonsense	probably null
R6929:Dnah6	UTSW	6	73044773	missense	probably damaging	0.96
R6981:Dnah6	UTSW	6	73021178	missense	probably benign	0.00
R7065:Dnah6	UTSW	6	73087562	missense	possibly damaging	0.87
R7139:Dnah6	UTSW	6	73135680	missense	probably damaging	1.00
R7169:Dnah6	UTSW	6	73038746	missense	probably damaging	1.00
R7202:Dnah6	UTSW	6	73181705	critical splice donor site	probably null
R7203:Dnah6	UTSW	6	73173545	missense	probably benign	0.00
R7315:Dnah6	UTSW	6	73084760	missense	probably damaging	1.00
R7329:Dnah6	UTSW	6	73144722	nonsense	probably null
R7387:Dnah6	UTSW	6	73212612	nonsense	probably null
R7388:Dnah6	UTSW	6	73192317	missense	possibly damaging	0.47
R7454:Dnah6	UTSW	6	73212492	missense	probably damaging	1.00
R7520:Dnah6	UTSW	6	73127904	missense	probably benign	0.04
R7524:Dnah6	UTSW	6	73118099	missense	probably damaging	1.00
R7548:Dnah6	UTSW	6	73027440	missense	probably damaging	1.00
R7570:Dnah6	UTSW	6	73149430	missense	probably benign	0.01
R7604:Dnah6	UTSW	6	73092168	missense	probably damaging	1.00
R7615:Dnah6	UTSW	6	73095206	missense	possibly damaging	0.85
R7622:Dnah6	UTSW	6	73124759	missense	possibly damaging	0.94
R7690:Dnah6	UTSW	6	73169080	splice site	probably null
R7735:Dnah6	UTSW	6	73069429	missense	probably damaging	1.00
R7754:Dnah6	UTSW	6	73025720	missense	probably benign	0.41
R7829:Dnah6	UTSW	6	73127919	nonsense	probably null
R7904:Dnah6	UTSW	6	73135467	splice site	probably null
R8034:Dnah6	UTSW	6	73129225	missense	probably damaging	1.00
R8093:Dnah6	UTSW	6	73160913	missense	probably damaging	1.00
R8120:Dnah6	UTSW	6	73025786	missense	probably damaging	1.00
R8178:Dnah6	UTSW	6	73060225	missense	probably benign	0.16
R8206:Dnah6	UTSW	6	73037566	nonsense	probably null
R8214:Dnah6	UTSW	6	73044728	missense	probably damaging	1.00
R8269:Dnah6	UTSW	6	73168827	critical splice donor site	probably null
R8273:Dnah6	UTSW	6	73076599	missense	probably benign	0.31
R8273:Dnah6	UTSW	6	73195681	missense	probably benign	0.00
R8331:Dnah6	UTSW	6	73025000	missense	probably benign	0.10
R8350:Dnah6	UTSW	6	73195815	missense	probably benign	0.41
R8428:Dnah6	UTSW	6	73074651	missense	probably benign	0.15
R8447:Dnah6	UTSW	6	73138774	missense	probably damaging	0.99
R8450:Dnah6	UTSW	6	73195815	missense	probably benign	0.41
R8517:Dnah6	UTSW	6	73178457	missense	probably benign	0.16
R8523:Dnah6	UTSW	6	73095188	missense	probably damaging	1.00
R8691:Dnah6	UTSW	6	73168867	missense	probably damaging	1.00
R8700:Dnah6	UTSW	6	73075890	intron	probably benign
R8737:Dnah6	UTSW	6	73067445	missense	possibly damaging	0.83
R8762:Dnah6	UTSW	6	73179828	missense	possibly damaging	0.83
R8804:Dnah6	UTSW	6	73065773	missense	probably benign
R8809:Dnah6	UTSW	6	73032563	missense	possibly damaging	0.94
R8813:Dnah6	UTSW	6	73127954	missense	probably damaging	1.00
R8849:Dnah6	UTSW	6	73144173	critical splice acceptor site	probably null
R8867:Dnah6	UTSW	6	73021148	missense	probably damaging	1.00
R8882:Dnah6	UTSW	6	73178498	missense	probably benign	0.05
R8973:Dnah6	UTSW	6	73144751	missense	probably benign	0.39
R9049:Dnah6	UTSW	6	73142292	missense	probably damaging	1.00
R9053:Dnah6	UTSW	6	73084657	missense	possibly damaging	0.94
R9064:Dnah6	UTSW	6	73149173	missense	probably benign	0.00
R9077:Dnah6	UTSW	6	73144046	nonsense	probably null
R9102:Dnah6	UTSW	6	73067486	missense	probably benign
R9106:Dnah6	UTSW	6	73144769	missense	probably damaging	1.00
R9119:Dnah6	UTSW	6	73060203	missense	possibly damaging	0.95
R9124:Dnah6	UTSW	6	73121899	missense	possibly damaging	0.78
R9165:Dnah6	UTSW	6	73144941	missense	probably damaging	1.00
R9182:Dnah6	UTSW	6	73144705	nonsense	probably null
R9200:Dnah6	UTSW	6	73027514	missense	probably benign	0.06
R9265:Dnah6	UTSW	6	73083057	missense	probably benign	0.02
R9368:Dnah6	UTSW	6	73021278	missense	probably benign	0.22
R9378:Dnah6	UTSW	6	73212530	missense	probably benign
R9439:Dnah6	UTSW	6	73035347	missense	possibly damaging	0.66
R9506:Dnah6	UTSW	6	73142316	missense	probably damaging	1.00
R9645:Dnah6	UTSW	6	73138767	missense	possibly damaging	0.82
R9731:Dnah6	UTSW	6	73191606	missense	probably benign	0.00
RF002:Dnah6	UTSW	6	73101889	missense	probably benign
RF020:Dnah6	UTSW	6	73118057	missense	probably benign	0.00
W0251:Dnah6	UTSW	6	73178518	missense	possibly damaging	0.95
X0025:Dnah6	UTSW	6	73037673	missense	probably damaging	1.00
X0025:Dnah6	UTSW	6	73191500	missense	probably benign	0.01
Z1176:Dnah6	UTSW	6	73087783	missense	possibly damaging	0.79
Z1176:Dnah6	UTSW	6	73133559	missense	probably benign
Z1177:Dnah6	UTSW	6	73021237	missense	probably benign	0.13
Z1177:Dnah6	UTSW	6	73032526	missense	probably damaging	0.99
Z1177:Dnah6	UTSW	6	73041138	missense	probably damaging	1.00
Z1177:Dnah6	UTSW	6	73155272	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ACGCGCTAGACAAGCTCAATGG -3'
(R):5'- ACTGATGAGGAAGAAGCCTTTGCTC -3'

Sequencing Primer
(F):5'- CTCAATGGGGAAAGCAAAACCTATG -3'
(R):5'- cacacacacacacacacac -3'

Posted On

2014-04-13