Incidental Mutation 'R1509:Nfatc3'
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
SynonymsNFATx, NFAT4, D8Ertd281e
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosomal Location106058840-106130537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106083854 bp
Amino Acid Change Phenylalanine to Leucine at position 421 (F421L)
Ref Sequence ENSEMBL: ENSMUSP00000148551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
Predicted Effect probably benign
Transcript: ENSMUST00000109308
AA Change: F429L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: F429L

low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211991
AA Change: F421L

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212577
Predicted Effect possibly damaging
Transcript: ENSMUST00000212742
AA Change: F421L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212936
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106099177 missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106127921 missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106078900 missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106108185 missense probably benign 0.29
Struggles UTSW 8 106083870 nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106059973 missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106079203 missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106127942 missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106092195 missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106096196 missense probably damaging 1.00
R1702:Nfatc3 UTSW 8 106092160 missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106083834 missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106078850 missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106099136 missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106108455 missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106092144 missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106079645 missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106099077 nonsense probably null
R4006:Nfatc3 UTSW 8 106108839 missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106079491 missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106079073 missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106108379 missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106079727 missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106108125 missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106079057 missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106079066 missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106096312 missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106083870 nonsense probably null
R6557:Nfatc3 UTSW 8 106119354 missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106083969 missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106119322 missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106108946 missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106079083 missense probably damaging 1.00
R7760:Nfatc3 UTSW 8 106108341 missense possibly damaging 0.66
X0063:Nfatc3 UTSW 8 106083939 missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106108349 missense probably benign 0.04
Z1177:Nfatc3 UTSW 8 106092066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATAGAGACcctggtgatggtagtg -3'

Sequencing Primer
(F):5'- gcaagttccaggatagccaaag -3'
Posted On2014-04-13