Mutagenetix > Incidental Mutation

Incidental Mutation 'R1509:Nfatc3'

168148

Institutional Source

Beutler Lab

Gene Symbol

Nfatc3

Ensembl Gene

ENSMUSG00000031902

Gene Name

nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3

Synonyms

NFATx, NFAT4, D8Ertd281e

MMRRC Submission

039556-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1509 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106058840-106130537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106083854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 421 (F421L)

Ref Sequence

ENSEMBL: ENSMUSP00000148551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000109308
AA Change: F429L

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: F429L

Domain	Start	End	E-Value	Type
low complexity region	153	182	N/A	INTRINSIC
low complexity region	205	225	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	286	305	N/A	INTRINSIC
Pfam:RHD_DNA_bind	434	593	4.9e-25	PFAM
IPT	600	699	1.19e-20	SMART
low complexity region	713	722	N/A	INTRINSIC
low complexity region	917	938	N/A	INTRINSIC
low complexity region	954	967	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211991
AA Change: F421L

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212577

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212742
AA Change: F421L

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212936

Meta Mutation Damage Score

0.0751

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 93.1%

Validation Efficiency

99% (89/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,192,647	S132P	probably benign	Het
4930430A15Rik	A	T	2: 111,218,627	M269K	probably benign	Het
AC153895.1	T	C	6: 50,043,471	R54G	unknown	Het
Acot12	G	A	13: 91,771,875		probably null	Het
Adhfe1	T	A	1: 9,553,446	D98E	probably benign	Het
Ago2	A	G	15: 73,116,364	F594S	probably damaging	Het
Aldh18a1	A	G	19: 40,557,483	I620T	probably damaging	Het
Aspscr1	C	A	11: 120,701,516	A294D	probably damaging	Het
BC067074	A	G	13: 113,368,256	N431S	probably damaging	Het
Bod1l	C	G	5: 41,819,540	R1477T	probably damaging	Het
Ccdc18	C	A	5: 108,188,978	A741D	possibly damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Cfap52	C	T	11: 67,938,993	V317I	probably benign	Het
Cgn	A	T	3: 94,774,258	L509Q	probably benign	Het
Crb2	A	G	2: 37,786,619	H204R	probably benign	Het
Ddx39	G	A	8: 83,719,898	V99M	probably damaging	Het
Dis3l2	T	A	1: 87,021,086	C582S	possibly damaging	Het
Dmbt1	G	A	7: 131,074,331		probably benign	Het
Dnah6	T	C	6: 73,027,442	E3846G	probably damaging	Het
Dstyk	A	G	1: 132,456,346	E655G	probably damaging	Het
Epha4	T	C	1: 77,380,886	Y825C	probably damaging	Het
Esp36	T	A	17: 38,417,282	N36I	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fem1c	A	G	18: 46,524,213	S145P	probably benign	Het
Galnt13	T	C	2: 54,733,082	I80T	probably damaging	Het
Gm10125	A	G	18: 5,583,794		noncoding transcript	Het
Gm5698	T	C	1: 30,977,647	T108A	probably benign	Het
Hipk3	A	G	2: 104,441,262	S442P	probably benign	Het
Hmcn2	T	A	2: 31,314,479	V22D	possibly damaging	Het
Hspg2	C	T	4: 137,511,241		probably benign	Het
Ide	A	G	19: 37,285,204		probably null	Het
Ifnar1	C	A	16: 91,503,496	P462Q	probably damaging	Het
Itgb2l	T	A	16: 96,426,849	I485F	probably benign	Het
Jakmip3	C	T	7: 139,027,776	R549W	possibly damaging	Het
Lrrc36	A	G	8: 105,461,129	Q680R	probably damaging	Het
Lysmd3	T	G	13: 81,669,271	H122Q	probably benign	Het
Macf1	C	A	4: 123,684,009	V61L	possibly damaging	Het
Map1b	T	C	13: 99,431,528	T1562A	unknown	Het
Map3k20	A	T	2: 72,364,624		probably benign	Het
Mroh8	A	G	2: 157,233,205	V457A	probably benign	Het
Mrpl40	T	A	16: 18,875,409		probably null	Het
Ms4a10	C	T	19: 10,964,108	V166I	probably benign	Het
Mycl	A	G	4: 123,000,307	D300G	probably damaging	Het
Naca	T	A	10: 128,043,397		probably benign	Het
Ncoa4	T	C	14: 32,173,434	S172P	probably damaging	Het
Nucb1	C	A	7: 45,495,225	K301N	probably benign	Het
Olfr1451	T	A	19: 12,999,451	I155N	possibly damaging	Het
Olfr366	A	G	2: 37,219,954	H155R	probably damaging	Het
Olfr629	A	T	7: 103,741,036	M68K	probably benign	Het
Panx1	A	T	9: 15,010,045	V178E	possibly damaging	Het
Pkd1l3	G	A	8: 109,640,770	V1210I	probably damaging	Het
Polr2a	A	T	11: 69,747,213	H143Q	possibly damaging	Het
Prdm12	G	A	2: 31,654,174	R263H	probably damaging	Het
Prkdc	A	C	16: 15,731,566	K1998T	probably damaging	Het
Rab11fip1	A	T	8: 27,153,023	S583T	probably damaging	Het
Rnf157	T	A	11: 116,347,095	T567S	probably benign	Het
Rp1	T	C	1: 4,347,694	K1065R	probably damaging	Het
Rp1	A	G	1: 4,348,537	I784T	probably benign	Het
Rps10	A	C	17: 27,631,208	F150V	probably benign	Het
Rrp12	A	T	19: 41,882,200	F499I	probably damaging	Het
Sez6l2	G	A	7: 126,963,363	R604H	probably damaging	Het
Slc25a21	G	T	12: 56,858,079	Q57K	probably benign	Het
Slc27a2	A	G	2: 126,553,314	T54A	possibly damaging	Het
Slc9a9	T	A	9: 95,228,958	S610T	probably benign	Het
Smc1b	A	T	15: 85,086,134	S973T	probably benign	Het
Smc6	G	A	12: 11,279,733	S164N	possibly damaging	Het
Sp1	A	G	15: 102,407,879	T32A	possibly damaging	Het
Spen	T	C	4: 141,475,635	I1894V	probably benign	Het
Spen	T	C	4: 141,475,700	K1872R	possibly damaging	Het
Stab1	C	A	14: 31,151,584		probably benign	Het
Taar7d	T	G	10: 24,028,204	F328C	probably damaging	Het
Ticam1	A	T	17: 56,271,113	S327R	probably benign	Het
Tmem248	C	T	5: 130,229,454		probably benign	Het
Tom1	T	C	8: 75,054,631	S83P	probably damaging	Het
Txk	T	A	5: 72,699,110	Y446F	probably damaging	Het
Ubap1l	T	A	9: 65,371,955	C179S	probably benign	Het
Utrn	T	C	10: 12,455,441	E474G	possibly damaging	Het
Vmn2r14	T	C	5: 109,215,996	M685V	probably benign	Het
Vmn2r7	A	T	3: 64,716,460	Y146*	probably null	Het
Wdr1	G	A	5: 38,540,562	T220M	probably damaging	Het
Xpo7	T	C	14: 70,678,142	D726G	probably damaging	Het
Zbtb14	C	G	17: 69,387,764	I152M	probably benign	Het
Zbtb3	A	G	19: 8,803,407	D128G	probably damaging	Het
Zfp462	T	A	4: 55,007,667	D35E	probably damaging	Het
Zfp467	A	G	6: 48,438,687	S344P	possibly damaging	Het
Zfpm1	A	T	8: 122,307,546	D73V	possibly damaging	Het

Other mutations in Nfatc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Nfatc3	APN	8	106099177	missense	probably damaging	1.00
IGL01755:Nfatc3	APN	8	106127921	missense	probably benign	0.42
IGL02314:Nfatc3	APN	8	106078900	missense	probably benign	0.21
IGL02724:Nfatc3	APN	8	106108185	missense	probably benign	0.29
Kampf	UTSW	8	106099150	missense	probably benign	0.23
Struggles	UTSW	8	106083870	nonsense	probably null
PIT1430001:Nfatc3	UTSW	8	106059973	missense	possibly damaging	0.78
PIT4515001:Nfatc3	UTSW	8	106079203	missense	possibly damaging	0.94
R0088:Nfatc3	UTSW	8	106127942	missense	possibly damaging	0.90
R0348:Nfatc3	UTSW	8	106092195	missense	probably damaging	1.00
R0410:Nfatc3	UTSW	8	106096196	missense	probably damaging	1.00
R1702:Nfatc3	UTSW	8	106092160	missense	probably damaging	1.00
R1735:Nfatc3	UTSW	8	106083834	missense	probably damaging	1.00
R1736:Nfatc3	UTSW	8	106078850	missense	probably damaging	1.00
R1758:Nfatc3	UTSW	8	106099136	missense	probably damaging	1.00
R2370:Nfatc3	UTSW	8	106108455	missense	probably damaging	1.00
R2878:Nfatc3	UTSW	8	106092144	missense	probably damaging	1.00
R3802:Nfatc3	UTSW	8	106079645	missense	probably damaging	0.99
R3959:Nfatc3	UTSW	8	106099077	nonsense	probably null
R4006:Nfatc3	UTSW	8	106108839	missense	probably benign	0.00
R4079:Nfatc3	UTSW	8	106079491	missense	probably damaging	0.98
R4589:Nfatc3	UTSW	8	106079073	missense	probably damaging	1.00
R4818:Nfatc3	UTSW	8	106108379	missense	probably benign	0.00
R4907:Nfatc3	UTSW	8	106079727	missense	probably damaging	1.00
R5042:Nfatc3	UTSW	8	106108125	missense	probably benign	0.25
R5632:Nfatc3	UTSW	8	106079057	missense	probably damaging	1.00
R5741:Nfatc3	UTSW	8	106079066	missense	probably damaging	1.00
R5885:Nfatc3	UTSW	8	106096312	missense	probably benign	0.00
R6439:Nfatc3	UTSW	8	106083870	nonsense	probably null
R6557:Nfatc3	UTSW	8	106119354	missense	probably benign	0.01
R6737:Nfatc3	UTSW	8	106083969	missense	probably damaging	1.00
R6925:Nfatc3	UTSW	8	106119322	missense	probably benign	0.00
R7260:Nfatc3	UTSW	8	106108946	missense	probably benign	0.00
R7429:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7430:Nfatc3	UTSW	8	106108403	missense	probably benign	0.00
R7526:Nfatc3	UTSW	8	106079083	missense	probably damaging	1.00
R7760:Nfatc3	UTSW	8	106108341	missense	possibly damaging	0.66
R8783:Nfatc3	UTSW	8	106099152	missense	possibly damaging	0.63
R8867:Nfatc3	UTSW	8	106079008	missense	probably damaging	1.00
R8978:Nfatc3	UTSW	8	106108770	missense	probably benign	0.03
R9021:Nfatc3	UTSW	8	106092113	missense	probably damaging	1.00
R9066:Nfatc3	UTSW	8	106099150	missense	probably benign	0.23
R9538:Nfatc3	UTSW	8	106108152	missense	probably benign	0.35
R9656:Nfatc3	UTSW	8	106104134	missense	probably damaging	1.00
X0063:Nfatc3	UTSW	8	106083939	missense	probably damaging	1.00
X0064:Nfatc3	UTSW	8	106108349	missense	probably benign	0.04
Z1177:Nfatc3	UTSW	8	106092066	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATAGAGACcctggtgatggtagtg -3'
(R):5'- TTTCCCCAGATAGAAAGTCAGGAAGGT -3'

Sequencing Primer
(F):5'- gcaagttccaggatagccaaag -3'
(R):5'- TGGACTAGCTAAGAAAATACTGCC -3'

Posted On

2014-04-13