Incidental Mutation 'R1509:Aspscr1'
ID168162
Institutional Source Beutler Lab
Gene Symbol Aspscr1
Ensembl Gene ENSMUSG00000025142
Gene Namealveolar soft part sarcoma chromosome region, candidate 1 (human)
SynonymsASPCR1, RCC17, TUG, ASPC, ASPL, 1190006K01Rik
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120672973-120709447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120701516 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 294 (A294D)
Ref Sequence ENSEMBL: ENSMUSP00000101765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026135] [ENSMUST00000103016] [ENSMUST00000106158] [ENSMUST00000106159] [ENSMUST00000106160] [ENSMUST00000168097] [ENSMUST00000168510] [ENSMUST00000168714] [ENSMUST00000168947]
Predicted Effect probably damaging
Transcript: ENSMUST00000026135
AA Change: A371D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026135
Gene: ENSMUSG00000025142
AA Change: A371D

DomainStartEndE-ValueType
Pfam:TUG-UBL1 15 78 1.4e-29 PFAM
low complexity region 193 206 N/A INTRINSIC
low complexity region 284 313 N/A INTRINSIC
coiled coil region 339 365 N/A INTRINSIC
UBX 378 459 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103016
AA Change: A294D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099305
Gene: ENSMUSG00000025142
AA Change: A294D

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106158
AA Change: A294D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101764
Gene: ENSMUSG00000025142
AA Change: A294D

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106159
AA Change: A294D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101765
Gene: ENSMUSG00000025142
AA Change: A294D

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
UBX 301 382 1.67e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106160
AA Change: A294D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101766
Gene: ENSMUSG00000025142
AA Change: A294D

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
coiled coil region 262 288 N/A INTRINSIC
Blast:UBX 301 361 2e-29 BLAST
SCOP:d1h8ca_ 308 364 2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163273
Predicted Effect unknown
Transcript: ENSMUST00000166838
AA Change: A81D
SMART Domains Protein: ENSMUSP00000127202
Gene: ENSMUSG00000025142
AA Change: A81D

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
coiled coil region 49 75 N/A INTRINSIC
Blast:UBX 89 119 7e-13 BLAST
SCOP:d1i42a_ 92 119 4e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000167678
AA Change: A69D
SMART Domains Protein: ENSMUSP00000128940
Gene: ENSMUSG00000025142
AA Change: A69D

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
coiled coil region 37 63 N/A INTRINSIC
Blast:UBX 77 107 8e-13 BLAST
SCOP:d1i42a_ 80 107 5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168097
Predicted Effect probably benign
Transcript: ENSMUST00000168510
SMART Domains Protein: ENSMUSP00000125931
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168714
SMART Domains Protein: ENSMUSP00000129462
Gene: ENSMUSG00000025142

DomainStartEndE-ValueType
SCOP:d1h8ca_ 12 82 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168947
Meta Mutation Damage Score 0.2055 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBX domain and interacts with glucose transporter type 4 (GLUT4). This protein is a tether, which sequesters the GLUT4 in intracellular vesicles in muscle and fat cells in the absence of insulin, and redistributes the GLUT4 to the plasma membrane within minutes of insulin stimulation. Translocation t(X;17)(p11;q25) of this gene with transcription factor TFE3 gene results in a ASPSCR1-TFE3 fusion protein in alveolar soft part sarcoma and in renal cell carcinomas. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Aspscr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02588:Aspscr1 APN 11 120677531 missense possibly damaging 0.93
IGL02683:Aspscr1 APN 11 120701226 missense probably damaging 1.00
IGL02719:Aspscr1 APN 11 120677579 missense probably damaging 1.00
I1329:Aspscr1 UTSW 11 120701240 missense probably damaging 0.99
R0113:Aspscr1 UTSW 11 120688925 missense probably damaging 1.00
R0277:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0323:Aspscr1 UTSW 11 120678420 missense probably damaging 1.00
R0457:Aspscr1 UTSW 11 120677618 missense probably benign 0.35
R0714:Aspscr1 UTSW 11 120703667 critical splice donor site probably null
R1435:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R1739:Aspscr1 UTSW 11 120678516 missense probably damaging 1.00
R1789:Aspscr1 UTSW 11 120688560 missense probably damaging 1.00
R1958:Aspscr1 UTSW 11 120689208 missense probably null 1.00
R2414:Aspscr1 UTSW 11 120689222 missense probably benign 0.00
R2432:Aspscr1 UTSW 11 120702566 intron probably benign
R4059:Aspscr1 UTSW 11 120686679 missense probably benign 0.22
R4159:Aspscr1 UTSW 11 120708676 missense probably damaging 1.00
R4703:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4705:Aspscr1 UTSW 11 120688945 missense possibly damaging 0.87
R4748:Aspscr1 UTSW 11 120701507 missense probably damaging 0.99
R5141:Aspscr1 UTSW 11 120689177 missense probably benign 0.01
R5869:Aspscr1 UTSW 11 120688920 missense possibly damaging 0.55
R7543:Aspscr1 UTSW 11 120709423 missense unknown
R7555:Aspscr1 UTSW 11 120673100 missense unknown
R7609:Aspscr1 UTSW 11 120677522 missense probably damaging 0.99
R7670:Aspscr1 UTSW 11 120689039 missense probably benign 0.00
R7946:Aspscr1 UTSW 11 120708617 missense
R7999:Aspscr1 UTSW 11 120678522 critical splice donor site probably null
R8299:Aspscr1 UTSW 11 120709074 missense
Predicted Primers PCR Primer
(F):5'- TGCCTGACGAGTTCTTTGAGGTGAC -3'
(R):5'- TTGCCTAGTGCAGCAGACAAAGCC -3'

Sequencing Primer
(F):5'- TTGGCCCAGCTCAAGAGTG -3'
(R):5'- GGCCTACCATGACACCTG -3'
Posted On2014-04-13