Incidental Mutation 'R1509:Stab1'
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Namestabilin 1
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosomal Location31139013-31168641 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 31151584 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
Predicted Effect probably benign
Transcript: ENSMUST00000036618
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 unclassified probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 intron probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7153:Stab1 UTSW 14 31160584 missense probably benign 0.16
R7213:Stab1 UTSW 14 31143673 missense probably benign
R7215:Stab1 UTSW 14 31160797 missense possibly damaging 0.93
R7319:Stab1 UTSW 14 31140826 missense probably damaging 1.00
R7389:Stab1 UTSW 14 31147239 missense probably benign 0.00
R7400:Stab1 UTSW 14 31157384 missense probably null 1.00
R7427:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7428:Stab1 UTSW 14 31159259 missense probably benign 0.00
R7484:Stab1 UTSW 14 31160317 missense probably benign 0.00
R7568:Stab1 UTSW 14 31152595 missense probably damaging 1.00
R7574:Stab1 UTSW 14 31154665 missense probably benign
R7619:Stab1 UTSW 14 31145237 missense probably benign
R7623:Stab1 UTSW 14 31140621 missense probably benign 0.03
R7721:Stab1 UTSW 14 31141456 missense possibly damaging 0.48
R7869:Stab1 UTSW 14 31154472 missense probably benign 0.01
R7952:Stab1 UTSW 14 31154472 missense probably benign 0.01
R8059:Stab1 UTSW 14 31160241 missense probably benign 0.02
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Z1176:Stab1 UTSW 14 31142038 missense probably benign 0.00
Z1176:Stab1 UTSW 14 31150660 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttgtggagacatggtaaacaaag -3'
Posted On2014-04-13