Incidental Mutation 'R1509:Sp1'
ID168176
Institutional Source Beutler Lab
Gene Symbol Sp1
Ensembl Gene ENSMUSG00000001280
Gene Nametrans-acting transcription factor 1
SynonymsSp1-1, 1110003E12Rik
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102406143-102436404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102407879 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 32 (T32A)
Ref Sequence ENSEMBL: ENSMUSP00000127445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001326] [ENSMUST00000163709] [ENSMUST00000165837] [ENSMUST00000165924] [ENSMUST00000168802] [ENSMUST00000169619] [ENSMUST00000170884]
Predicted Effect probably benign
Transcript: ENSMUST00000001326
AA Change: T39A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001326
Gene: ENSMUSG00000001280
AA Change: T39A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
low complexity region 300 333 N/A INTRINSIC
low complexity region 341 354 N/A INTRINSIC
low complexity region 370 422 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
ZnF_C2H2 624 648 4.34e0 SMART
ZnF_C2H2 654 678 1.98e-4 SMART
ZnF_C2H2 684 706 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163709
AA Change: T39A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130747
Gene: ENSMUSG00000001280
AA Change: T39A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 108 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
ZnF_C2H2 310 334 4.34e0 SMART
ZnF_C2H2 340 364 1.98e-4 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165837
AA Change: T32A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126143
Gene: ENSMUSG00000001280
AA Change: T32A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165924
AA Change: T39A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132401
Gene: ENSMUSG00000001280
AA Change: T39A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
low complexity region 300 333 N/A INTRINSIC
low complexity region 341 354 N/A INTRINSIC
low complexity region 370 422 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
ZnF_C2H2 624 648 4.34e0 SMART
ZnF_C2H2 654 678 1.98e-4 SMART
ZnF_C2H2 684 706 1.12e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168802
AA Change: T32A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127445
Gene: ENSMUSG00000001280
AA Change: T32A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169619
AA Change: T32A
SMART Domains Protein: ENSMUSP00000127714
Gene: ENSMUSG00000001280
AA Change: T32A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170884
AA Change: T32A
SMART Domains Protein: ENSMUSP00000129638
Gene: ENSMUSG00000001280
AA Change: T32A

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display reduced embryo size and die during organogenesis with a broad range of developmental defects. Heterozygous null mice are viable but slightly growth retarded, may lack one or both eyes, and show a decreased erythroid progenitor cell number in fetal liver cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Sp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Sp1 APN 15 102430929 missense probably damaging 1.00
PIT4812001:Sp1 UTSW 15 102408408 missense possibly damaging 0.53
R0758:Sp1 UTSW 15 102406370 unclassified probably null
R1611:Sp1 UTSW 15 102430935 missense probably damaging 0.99
R1820:Sp1 UTSW 15 102409076 missense possibly damaging 0.73
R1824:Sp1 UTSW 15 102431003 missense possibly damaging 0.70
R2107:Sp1 UTSW 15 102409678 unclassified probably null
R4508:Sp1 UTSW 15 102409312 missense possibly damaging 0.53
R4857:Sp1 UTSW 15 102430974 missense probably damaging 0.99
R5512:Sp1 UTSW 15 102431010 missense possibly damaging 0.91
R5559:Sp1 UTSW 15 102408930 missense probably benign 0.18
R5833:Sp1 UTSW 15 102430917 missense possibly damaging 0.92
R6377:Sp1 UTSW 15 102430883 missense probably benign 0.13
R8059:Sp1 UTSW 15 102407902 missense possibly damaging 0.73
X0050:Sp1 UTSW 15 102409411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATAGTGGCCTGTCTTGGGCACC -3'
(R):5'- GTTCCAACTTTCGTATCTGGGGACC -3'

Sequencing Primer
(F):5'- gaacttttgcctccacttcc -3'
(R):5'- GGGGACCCTCTAGATCACCTATC -3'
Posted On2014-04-13