Incidental Mutation 'R1509:Olfr1451'
ID168189
Institutional Source Beutler Lab
Gene Symbol Olfr1451
Ensembl Gene ENSMUSG00000046913
Gene Nameolfactory receptor 1451
SynonymsGA_x6K02T2RE5P-3328502-3329434, MOR202-1
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12995014-13000417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12999451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 155 (I155N)
Ref Sequence ENSEMBL: ENSMUSP00000146874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063144] [ENSMUST00000207997]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063144
AA Change: I155N

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049885
Gene: ENSMUSG00000046913
AA Change: I155N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 2.2e-5 PFAM
Pfam:7tm_1 39 289 6.9e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207997
AA Change: I155N

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Olfr1451
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr1451 APN 19 12999319 missense probably damaging 1.00
IGL01301:Olfr1451 APN 19 12999417 missense probably damaging 0.99
IGL01369:Olfr1451 APN 19 12999761 missense possibly damaging 0.78
IGL02098:Olfr1451 APN 19 12999573 missense probably benign 0.00
IGL02106:Olfr1451 APN 19 12999565 missense possibly damaging 0.80
IGL02369:Olfr1451 APN 19 12999708 missense probably damaging 1.00
ANU18:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
R0316:Olfr1451 UTSW 19 12999402 missense probably damaging 1.00
R0926:Olfr1451 UTSW 19 12999190 missense probably damaging 1.00
R0988:Olfr1451 UTSW 19 12999787 missense probably benign 0.39
R1268:Olfr1451 UTSW 19 12999261 missense possibly damaging 0.80
R1991:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2103:Olfr1451 UTSW 19 12999502 missense possibly damaging 0.60
R2132:Olfr1451 UTSW 19 12999038 missense probably benign 0.21
R2206:Olfr1451 UTSW 19 12999040 missense probably benign 0.06
R3687:Olfr1451 UTSW 19 12999102 missense probably damaging 1.00
R4077:Olfr1451 UTSW 19 12999871 missense probably damaging 1.00
R4803:Olfr1451 UTSW 19 12999169 missense probably damaging 1.00
R4948:Olfr1451 UTSW 19 12999831 missense probably benign 0.06
R4999:Olfr1451 UTSW 19 12999219 missense probably benign 0.03
R6274:Olfr1451 UTSW 19 12999870 missense probably damaging 0.97
R6843:Olfr1451 UTSW 19 12998998 missense probably benign 0.09
R6928:Olfr1451 UTSW 19 12999838 missense probably damaging 0.99
R6941:Olfr1451 UTSW 19 12999497 missense possibly damaging 0.86
R7485:Olfr1451 UTSW 19 12999558 missense probably benign 0.03
R7611:Olfr1451 UTSW 19 12999067 missense possibly damaging 0.93
R7823:Olfr1451 UTSW 19 12999417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTTTGCCACTGGGGAAAATTACC -3'
(R):5'- CATCCATAGAATGGCTGGAGCTGG -3'

Sequencing Primer
(F):5'- CACTGGGGAAAATTACCTCTTAGC -3'
(R):5'- GGTCTGACTTCATCTTCAAGACAG -3'
Posted On2014-04-13