Incidental Mutation 'R1509:Ide'
Institutional Source Beutler Lab
Gene Symbol Ide
Ensembl Gene ENSMUSG00000056999
Gene Nameinsulin degrading enzyme
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1509 (G1)
Quality Score225
Status Validated
Chromosomal Location37268743-37337852 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 37285204 bp
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect probably null
Transcript: ENSMUST00000131070
SMART Domains Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999

Pfam:Peptidase_M16 42 180 8.1e-49 PFAM
Pfam:Peptidase_M16_C 205 385 2.1e-25 PFAM
Pfam:Peptidase_M16_M 389 671 1.9e-106 PFAM
Pfam:Peptidase_M16_C 674 857 9.4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131070
SMART Domains Protein: ENSMUSP00000121358
Gene: ENSMUSG00000056999

Pfam:Peptidase_M16 42 180 8.1e-49 PFAM
Pfam:Peptidase_M16_C 205 385 2.1e-25 PFAM
Pfam:Peptidase_M16_M 389 671 1.9e-106 PFAM
Pfam:Peptidase_M16_C 674 857 9.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154339
Meta Mutation Damage Score 0.9584 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc metallopeptidase that degrades intracellular insulin, and thereby terminates insulins activity, as well as participating in intercellular peptide signalling by degrading diverse peptides such as glucagon, amylin, bradykinin, and kallidin. The preferential affinity of this enzyme for insulin results in insulin-mediated inhibition of the degradation of other peptides such as beta-amyloid. Deficiencies in this protein's function are associated with Alzheimer's disease and type 2 diabetes mellitus but mutations in this gene have not been shown to be causitive for these diseases. This protein localizes primarily to the cytoplasm but in some cell types localizes to the extracellular space, cell membrane, peroxisome, and mitochondrion. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described but have not been experimentally verified.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption of this gene display beta amyloid accumulations in the brain, hyperinsulinemia and glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Rrp12 A T 19: 41,882,200 F499I probably damaging Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Ide
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ide APN 19 37276532 missense unknown
IGL01924:Ide APN 19 37272164 missense unknown
IGL01925:Ide APN 19 37277897 missense unknown
IGL02616:Ide APN 19 37298056 missense unknown
R0738:Ide UTSW 19 37277965 nonsense probably null
R1557:Ide UTSW 19 37280761 splice site probably null
R2935:Ide UTSW 19 37325307 missense unknown
R4260:Ide UTSW 19 37329186 missense unknown
R4261:Ide UTSW 19 37329186 missense unknown
R4575:Ide UTSW 19 37272205 missense unknown
R4913:Ide UTSW 19 37329070 missense unknown
R4933:Ide UTSW 19 37277756 missense unknown
R4951:Ide UTSW 19 37285232 missense unknown
R5102:Ide UTSW 19 37314984 missense unknown
R5474:Ide UTSW 19 37272184 missense unknown
R5502:Ide UTSW 19 37330456 missense unknown
R5546:Ide UTSW 19 37272224 missense unknown
R5601:Ide UTSW 19 37314980 missense unknown
R5696:Ide UTSW 19 37318021 missense unknown
R5884:Ide UTSW 19 37272153 critical splice donor site probably null
R5983:Ide UTSW 19 37272150 splice site probably null
R6286:Ide UTSW 19 37278010 missense unknown
R7146:Ide UTSW 19 37295944 missense
R7224:Ide UTSW 19 37290761 missense
R7234:Ide UTSW 19 37290785 missense
R7695:Ide UTSW 19 37329036 missense
R7771:Ide UTSW 19 37298126 missense
R7811:Ide UTSW 19 37330511 missense
R7893:Ide UTSW 19 37284151 missense
R7976:Ide UTSW 19 37284151 missense
Z1176:Ide UTSW 19 37315491 missense
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttcaaaacaacaaacaacaaaaacc -3'
Posted On2014-04-13