Incidental Mutation 'R1509:Rrp12'
ID168192
Institutional Source Beutler Lab
Gene Symbol Rrp12
Ensembl Gene ENSMUSG00000035049
Gene Nameribosomal RNA processing 12 homolog (S. cerevisiae)
Synonyms
MMRRC Submission 039556-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R1509 (G1)
Quality Score135
Status Validated
Chromosome19
Chromosomal Location41862852-41896153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41882200 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 499 (F499I)
Ref Sequence ENSEMBL: ENSMUSP00000039853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038677]
Predicted Effect probably damaging
Transcript: ENSMUST00000038677
AA Change: F499I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039853
Gene: ENSMUSG00000035049
AA Change: F499I

DomainStartEndE-ValueType
low complexity region 164 175 N/A INTRINSIC
Pfam:NUC173 473 670 1.2e-72 PFAM
SCOP:d1qbkb_ 711 1087 2e-6 SMART
low complexity region 1157 1184 N/A INTRINSIC
low complexity region 1231 1243 N/A INTRINSIC
Meta Mutation Damage Score 0.7012 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency 99% (89/90)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,192,647 S132P probably benign Het
4930430A15Rik A T 2: 111,218,627 M269K probably benign Het
AC153895.1 T C 6: 50,043,471 R54G unknown Het
Acot12 G A 13: 91,771,875 probably null Het
Adhfe1 T A 1: 9,553,446 D98E probably benign Het
Ago2 A G 15: 73,116,364 F594S probably damaging Het
Aldh18a1 A G 19: 40,557,483 I620T probably damaging Het
Aspscr1 C A 11: 120,701,516 A294D probably damaging Het
BC067074 A G 13: 113,368,256 N431S probably damaging Het
Bod1l C G 5: 41,819,540 R1477T probably damaging Het
Ccdc18 C A 5: 108,188,978 A741D possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap52 C T 11: 67,938,993 V317I probably benign Het
Cgn A T 3: 94,774,258 L509Q probably benign Het
Crb2 A G 2: 37,786,619 H204R probably benign Het
Ddx39 G A 8: 83,719,898 V99M probably damaging Het
Dis3l2 T A 1: 87,021,086 C582S possibly damaging Het
Dmbt1 G A 7: 131,074,331 probably benign Het
Dnah6 T C 6: 73,027,442 E3846G probably damaging Het
Dstyk A G 1: 132,456,346 E655G probably damaging Het
Epha4 T C 1: 77,380,886 Y825C probably damaging Het
Esp36 T A 17: 38,417,282 N36I probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fem1c A G 18: 46,524,213 S145P probably benign Het
Galnt13 T C 2: 54,733,082 I80T probably damaging Het
Gm10125 A G 18: 5,583,794 noncoding transcript Het
Gm5698 T C 1: 30,977,647 T108A probably benign Het
Hipk3 A G 2: 104,441,262 S442P probably benign Het
Hmcn2 T A 2: 31,314,479 V22D possibly damaging Het
Hspg2 C T 4: 137,511,241 probably benign Het
Ide A G 19: 37,285,204 probably null Het
Ifnar1 C A 16: 91,503,496 P462Q probably damaging Het
Itgb2l T A 16: 96,426,849 I485F probably benign Het
Jakmip3 C T 7: 139,027,776 R549W possibly damaging Het
Lrrc36 A G 8: 105,461,129 Q680R probably damaging Het
Lysmd3 T G 13: 81,669,271 H122Q probably benign Het
Macf1 C A 4: 123,684,009 V61L possibly damaging Het
Map1b T C 13: 99,431,528 T1562A unknown Het
Map3k20 A T 2: 72,364,624 probably benign Het
Mroh8 A G 2: 157,233,205 V457A probably benign Het
Mrpl40 T A 16: 18,875,409 probably null Het
Ms4a10 C T 19: 10,964,108 V166I probably benign Het
Mycl A G 4: 123,000,307 D300G probably damaging Het
Naca T A 10: 128,043,397 probably benign Het
Ncoa4 T C 14: 32,173,434 S172P probably damaging Het
Nfatc3 T C 8: 106,083,854 F421L possibly damaging Het
Nucb1 C A 7: 45,495,225 K301N probably benign Het
Olfr1451 T A 19: 12,999,451 I155N possibly damaging Het
Olfr366 A G 2: 37,219,954 H155R probably damaging Het
Olfr629 A T 7: 103,741,036 M68K probably benign Het
Panx1 A T 9: 15,010,045 V178E possibly damaging Het
Pkd1l3 G A 8: 109,640,770 V1210I probably damaging Het
Polr2a A T 11: 69,747,213 H143Q possibly damaging Het
Prdm12 G A 2: 31,654,174 R263H probably damaging Het
Prkdc A C 16: 15,731,566 K1998T probably damaging Het
Rab11fip1 A T 8: 27,153,023 S583T probably damaging Het
Rnf157 T A 11: 116,347,095 T567S probably benign Het
Rp1 T C 1: 4,347,694 K1065R probably damaging Het
Rp1 A G 1: 4,348,537 I784T probably benign Het
Rps10 A C 17: 27,631,208 F150V probably benign Het
Sez6l2 G A 7: 126,963,363 R604H probably damaging Het
Slc25a21 G T 12: 56,858,079 Q57K probably benign Het
Slc27a2 A G 2: 126,553,314 T54A possibly damaging Het
Slc9a9 T A 9: 95,228,958 S610T probably benign Het
Smc1b A T 15: 85,086,134 S973T probably benign Het
Smc6 G A 12: 11,279,733 S164N possibly damaging Het
Sp1 A G 15: 102,407,879 T32A possibly damaging Het
Spen T C 4: 141,475,635 I1894V probably benign Het
Spen T C 4: 141,475,700 K1872R possibly damaging Het
Stab1 C A 14: 31,151,584 probably benign Het
Taar7d T G 10: 24,028,204 F328C probably damaging Het
Ticam1 A T 17: 56,271,113 S327R probably benign Het
Tmem248 C T 5: 130,229,454 probably benign Het
Tom1 T C 8: 75,054,631 S83P probably damaging Het
Txk T A 5: 72,699,110 Y446F probably damaging Het
Ubap1l T A 9: 65,371,955 C179S probably benign Het
Utrn T C 10: 12,455,441 E474G possibly damaging Het
Vmn2r14 T C 5: 109,215,996 M685V probably benign Het
Vmn2r7 A T 3: 64,716,460 Y146* probably null Het
Wdr1 G A 5: 38,540,562 T220M probably damaging Het
Xpo7 T C 14: 70,678,142 D726G probably damaging Het
Zbtb14 C G 17: 69,387,764 I152M probably benign Het
Zbtb3 A G 19: 8,803,407 D128G probably damaging Het
Zfp462 T A 4: 55,007,667 D35E probably damaging Het
Zfp467 A G 6: 48,438,687 S344P possibly damaging Het
Zfpm1 A T 8: 122,307,546 D73V possibly damaging Het
Other mutations in Rrp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Rrp12 APN 19 41887094 missense possibly damaging 0.94
IGL00430:Rrp12 APN 19 41877334 critical splice donor site probably null
IGL00496:Rrp12 APN 19 41878027 critical splice donor site probably null
IGL00953:Rrp12 APN 19 41871792 missense possibly damaging 0.51
IGL01320:Rrp12 APN 19 41877936 missense probably damaging 1.00
IGL01479:Rrp12 APN 19 41865202 missense probably benign 0.05
IGL01939:Rrp12 APN 19 41870895 missense probably damaging 0.99
IGL02147:Rrp12 APN 19 41886181 missense probably damaging 1.00
IGL02255:Rrp12 APN 19 41872971 missense probably damaging 1.00
IGL02756:Rrp12 APN 19 41896061 missense probably benign 0.03
IGL02793:Rrp12 APN 19 41871566 missense probably damaging 1.00
IGL03026:Rrp12 APN 19 41872997 missense probably damaging 1.00
IGL03202:Rrp12 APN 19 41868766 splice site probably null
IGL03393:Rrp12 APN 19 41871793 missense possibly damaging 0.91
R0137:Rrp12 UTSW 19 41873850 missense probably benign
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0234:Rrp12 UTSW 19 41871760 missense probably damaging 1.00
R0522:Rrp12 UTSW 19 41874705 splice site probably benign
R0616:Rrp12 UTSW 19 41892549 missense possibly damaging 0.95
R1537:Rrp12 UTSW 19 41886803 missense probably damaging 0.97
R1593:Rrp12 UTSW 19 41863241 missense probably benign 0.00
R1635:Rrp12 UTSW 19 41868785 missense probably benign 0.00
R1642:Rrp12 UTSW 19 41871737 missense probably damaging 1.00
R1696:Rrp12 UTSW 19 41873749 missense probably damaging 1.00
R1827:Rrp12 UTSW 19 41880481 missense possibly damaging 0.95
R1844:Rrp12 UTSW 19 41877783 critical splice donor site probably null
R1950:Rrp12 UTSW 19 41892590 missense probably damaging 1.00
R2010:Rrp12 UTSW 19 41872937 missense probably benign
R2115:Rrp12 UTSW 19 41891094 missense probably benign 0.38
R2136:Rrp12 UTSW 19 41892599 missense probably damaging 1.00
R2386:Rrp12 UTSW 19 41871284 missense probably benign 0.41
R3741:Rrp12 UTSW 19 41885728 missense probably damaging 1.00
R4096:Rrp12 UTSW 19 41887148 missense probably benign 0.32
R4292:Rrp12 UTSW 19 41872905 splice site probably null
R4407:Rrp12 UTSW 19 41892551 missense probably damaging 1.00
R4629:Rrp12 UTSW 19 41883516 missense probably benign 0.03
R4698:Rrp12 UTSW 19 41873042 missense probably benign 0.12
R4702:Rrp12 UTSW 19 41871536 missense probably damaging 1.00
R4716:Rrp12 UTSW 19 41877428 missense probably damaging 1.00
R4837:Rrp12 UTSW 19 41877505 splice site probably null
R5282:Rrp12 UTSW 19 41876590 missense probably benign
R5327:Rrp12 UTSW 19 41892596 missense probably damaging 1.00
R5621:Rrp12 UTSW 19 41880417 missense probably benign
R5762:Rrp12 UTSW 19 41880152 missense possibly damaging 0.88
R5947:Rrp12 UTSW 19 41870808 critical splice donor site probably null
R6213:Rrp12 UTSW 19 41868778 missense probably benign
R6407:Rrp12 UTSW 19 41883742 missense probably damaging 0.98
R6980:Rrp12 UTSW 19 41890143 missense probably damaging 0.98
R7179:Rrp12 UTSW 19 41883778 missense probably benign 0.03
R7186:Rrp12 UTSW 19 41871305 critical splice acceptor site probably null
R7194:Rrp12 UTSW 19 41871540 missense probably benign
R7206:Rrp12 UTSW 19 41878039 missense probably damaging 1.00
R7209:Rrp12 UTSW 19 41872949 missense possibly damaging 0.62
R7248:Rrp12 UTSW 19 41883438 missense possibly damaging 0.82
Z1177:Rrp12 UTSW 19 41865567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATGGGCACTGTCAACATGGG -3'
(R):5'- TGGGACCAGCCAAGTATACACAGG -3'

Sequencing Primer
(F):5'- TGTCAACATGGGGGGCG -3'
(R):5'- cctcatctgaaaatggagcatattac -3'
Posted On2014-04-13