Incidental Mutation 'R1515:Gpr35'
ID168198
Institutional Source Beutler Lab
Gene Symbol Gpr35
Ensembl Gene ENSMUSG00000026271
Gene NameG protein-coupled receptor 35
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1515 (G1)
Quality Score166
Status Not validated
Chromosome1
Chromosomal Location92950865-92986391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 92983048 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 161 (F161V)
Ref Sequence ENSEMBL: ENSMUSP00000139648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027489] [ENSMUST00000064480] [ENSMUST00000169198] [ENSMUST00000185421] [ENSMUST00000186298] [ENSMUST00000189697]
Predicted Effect probably benign
Transcript: ENSMUST00000027489
SMART Domains Protein: ENSMUSP00000027489
Gene: ENSMUSG00000026271

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 1.8e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000064480
AA Change: F161V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070832
Gene: ENSMUSG00000026271
AA Change: F161V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169198
AA Change: F161V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126914
Gene: ENSMUSG00000026271
AA Change: F161V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185421
Predicted Effect probably damaging
Transcript: ENSMUST00000186298
AA Change: F161V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139648
Gene: ENSMUSG00000026271
AA Change: F161V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 289 3.5e-7 PFAM
Pfam:7tm_1 34 275 3.6e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189697
SMART Domains Protein: ENSMUSP00000139787
Gene: ENSMUSG00000026271

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 28 147 5.7e-6 PFAM
Pfam:7tm_1 34 147 1.4e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Gpr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Gpr35 APN 1 92982872 missense probably damaging 0.99
IGL03102:Gpr35 APN 1 92982577 missense probably benign 0.00
PIT4280001:Gpr35 UTSW 1 92982634 missense probably damaging 1.00
R0015:Gpr35 UTSW 1 92983232 missense probably damaging 1.00
R0412:Gpr35 UTSW 1 92982784 missense probably benign 0.01
R1203:Gpr35 UTSW 1 92983148 missense probably damaging 0.98
R2872:Gpr35 UTSW 1 92983126 missense probably benign 0.34
R2872:Gpr35 UTSW 1 92983126 missense probably benign 0.34
R3498:Gpr35 UTSW 1 92983391 missense probably damaging 1.00
R3499:Gpr35 UTSW 1 92983391 missense probably damaging 1.00
R4732:Gpr35 UTSW 1 92983385 missense probably damaging 1.00
R4733:Gpr35 UTSW 1 92983385 missense probably damaging 1.00
R5270:Gpr35 UTSW 1 92982577 missense probably benign 0.00
R5969:Gpr35 UTSW 1 92983220 missense probably damaging 1.00
R6769:Gpr35 UTSW 1 92982704 missense probably damaging 0.97
R6771:Gpr35 UTSW 1 92982704 missense probably damaging 0.97
R7144:Gpr35 UTSW 1 92982631 missense probably benign 0.11
R7395:Gpr35 UTSW 1 92983207 missense probably damaging 1.00
R8156:Gpr35 UTSW 1 92982715 missense probably damaging 1.00
Z1177:Gpr35 UTSW 1 92983016 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATAAGCCTGGTCACTGCCATTG -3'
(R):5'- ATTGAGGTTCAGGGAGACCTGCAC -3'

Sequencing Primer
(F):5'- ACTGCCATTGCTGTGGAC -3'
(R):5'- TCAGGACCACATGCAAGG -3'
Posted On2014-04-13