Incidental Mutation 'R1515:F13b'
ID168199
Institutional Source Beutler Lab
Gene Symbol F13b
Ensembl Gene ENSMUSG00000026368
Gene Namecoagulation factor XIII, beta subunit
SynonymsCf-13b, Cf13b
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location139501702-139523752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139510965 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 369 (Y369C)
Ref Sequence ENSEMBL: ENSMUSP00000027615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027615]
Predicted Effect probably damaging
Transcript: ENSMUST00000027615
AA Change: Y369C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: Y369C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 26 88 1.26e-7 SMART
CCP 92 147 2.11e-9 SMART
CCP 154 209 9.83e-10 SMART
CCP 214 268 7.62e-16 SMART
CCP 275 328 8.62e-15 SMART
CCP 337 390 4.62e-15 SMART
CCP 397 451 3.5e-15 SMART
Blast:CCP 455 516 1e-28 BLAST
CCP 525 579 2.44e-14 SMART
Blast:CCP 583 647 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in F13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:F13b APN 1 139510587 missense probably benign 0.01
IGL00937:F13b APN 1 139517360 splice site probably benign
IGL01138:F13b APN 1 139517212 missense probably damaging 0.99
IGL01319:F13b APN 1 139506793 missense probably damaging 0.98
IGL01328:F13b APN 1 139508082 splice site probably benign
IGL01621:F13b APN 1 139503851 missense probably benign 0.00
IGL01843:F13b APN 1 139516427 missense probably damaging 1.00
IGL02153:F13b APN 1 139516377 missense probably damaging 1.00
IGL02192:F13b APN 1 139517333 missense probably damaging 1.00
IGL02555:F13b APN 1 139517186 missense probably damaging 1.00
IGL03036:F13b APN 1 139508115 missense possibly damaging 0.80
IGL03185:F13b APN 1 139516386 missense probably benign 0.03
IGL03303:F13b APN 1 139513036 missense possibly damaging 0.67
IGL03335:F13b APN 1 139522386 missense probably damaging 1.00
IGL03371:F13b APN 1 139506936 missense probably damaging 1.00
R0139:F13b UTSW 1 139508203 missense probably damaging 0.96
R0157:F13b UTSW 1 139503847 missense probably benign
R0381:F13b UTSW 1 139510859 missense probably damaging 0.98
R0492:F13b UTSW 1 139522559 splice site probably null
R0589:F13b UTSW 1 139506933 missense possibly damaging 0.94
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1462:F13b UTSW 1 139507636 missense probably damaging 1.00
R1869:F13b UTSW 1 139510934 missense probably benign 0.44
R2047:F13b UTSW 1 139508223 missense probably damaging 1.00
R2218:F13b UTSW 1 139506844 missense probably benign 0.42
R2878:F13b UTSW 1 139501747 start codon destroyed probably null
R3032:F13b UTSW 1 139517333 missense probably damaging 1.00
R4077:F13b UTSW 1 139501770 missense unknown
R4079:F13b UTSW 1 139501770 missense unknown
R4208:F13b UTSW 1 139516341 missense probably damaging 1.00
R4350:F13b UTSW 1 139516298 missense probably benign 0.00
R4674:F13b UTSW 1 139501804 missense unknown
R4675:F13b UTSW 1 139501804 missense unknown
R4972:F13b UTSW 1 139510923 missense probably damaging 1.00
R5212:F13b UTSW 1 139512987 missense probably benign
R5343:F13b UTSW 1 139510544 missense possibly damaging 0.61
R5503:F13b UTSW 1 139522543 missense probably benign 0.00
R5984:F13b UTSW 1 139508212 missense probably damaging 1.00
R7012:F13b UTSW 1 139516358 missense probably benign
R7155:F13b UTSW 1 139508157 missense probably damaging 1.00
R7250:F13b UTSW 1 139516489 critical splice donor site probably null
R7478:F13b UTSW 1 139507695 missense probably benign 0.01
Z1088:F13b UTSW 1 139508202 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TGCTCTGTGAAAATGGGAAGTGGAC -3'
(R):5'- AGCCAAGAATCCCTCTGCTTGC -3'

Sequencing Primer
(F):5'- GTGGACAGAACCTCCAAAATGTATTG -3'
(R):5'- ACATCTCACAGAAGTGTGGTC -3'
Posted On2014-04-13