Incidental Mutation 'R1515:Lamc3'
ID 168201
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Name laminin gamma 3
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 31777303-31836551 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31830763 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1500 (D1500G)
Ref Sequence ENSEMBL: ENSMUSP00000118745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
AlphaFold Q9R0B6
Predicted Effect probably damaging
Transcript: ENSMUST00000028187
AA Change: D1489G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: D1489G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138325
AA Change: D1500G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: D1500G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31,790,593 (GRCm39) missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31,808,533 (GRCm39) missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31,804,668 (GRCm39) missense probably benign 0.07
IGL01086:Lamc3 APN 2 31,788,488 (GRCm39) missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31,802,119 (GRCm39) missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31,788,290 (GRCm39) missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31,777,667 (GRCm39) missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31,804,616 (GRCm39) splice site probably benign
IGL02340:Lamc3 APN 2 31,808,469 (GRCm39) missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31,795,977 (GRCm39) missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31,810,674 (GRCm39) missense probably benign 0.00
IGL02679:Lamc3 APN 2 31,835,410 (GRCm39) missense probably benign 0.01
IGL02751:Lamc3 APN 2 31,810,716 (GRCm39) missense probably benign 0.07
IGL02820:Lamc3 APN 2 31,813,034 (GRCm39) missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31,825,738 (GRCm39) splice site probably benign
IGL02926:Lamc3 APN 2 31,825,737 (GRCm39) splice site probably benign
IGL03090:Lamc3 APN 2 31,798,710 (GRCm39) splice site probably benign
IGL03258:Lamc3 APN 2 31,777,695 (GRCm39) missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31,812,440 (GRCm39) missense probably benign 0.07
R0137:Lamc3 UTSW 2 31,798,628 (GRCm39) missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31,805,096 (GRCm39) splice site probably benign
R0244:Lamc3 UTSW 2 31,830,733 (GRCm39) missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31,827,980 (GRCm39) missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31,818,814 (GRCm39) missense probably benign 0.03
R1142:Lamc3 UTSW 2 31,830,733 (GRCm39) missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31,818,859 (GRCm39) missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31,777,423 (GRCm39) missense probably benign
R1642:Lamc3 UTSW 2 31,806,008 (GRCm39) missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31,811,793 (GRCm39) missense probably null 0.01
R1707:Lamc3 UTSW 2 31,802,141 (GRCm39) critical splice donor site probably null
R1714:Lamc3 UTSW 2 31,830,769 (GRCm39) missense probably benign 0.02
R1838:Lamc3 UTSW 2 31,815,594 (GRCm39) missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31,830,714 (GRCm39) missense probably benign 0.02
R3177:Lamc3 UTSW 2 31,798,637 (GRCm39) missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31,798,637 (GRCm39) missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31,814,604 (GRCm39) missense probably benign 0.01
R4065:Lamc3 UTSW 2 31,835,270 (GRCm39) missense probably benign 0.00
R4089:Lamc3 UTSW 2 31,810,520 (GRCm39) nonsense probably null
R4373:Lamc3 UTSW 2 31,788,244 (GRCm39) missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4395:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4397:Lamc3 UTSW 2 31,821,964 (GRCm39) missense probably benign
R4746:Lamc3 UTSW 2 31,795,626 (GRCm39) missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31,830,748 (GRCm39) missense probably benign 0.02
R4960:Lamc3 UTSW 2 31,805,966 (GRCm39) missense probably benign 0.00
R5025:Lamc3 UTSW 2 31,798,681 (GRCm39) missense probably benign 0.13
R5062:Lamc3 UTSW 2 31,795,679 (GRCm39) missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31,777,356 (GRCm39) start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31,808,608 (GRCm39) missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31,821,997 (GRCm39) missense probably benign
R5655:Lamc3 UTSW 2 31,815,729 (GRCm39) missense probably benign 0.01
R5928:Lamc3 UTSW 2 31,811,721 (GRCm39) missense probably benign 0.00
R6018:Lamc3 UTSW 2 31,795,724 (GRCm39) missense probably damaging 1.00
R6479:Lamc3 UTSW 2 31,777,413 (GRCm39) missense probably benign
R6601:Lamc3 UTSW 2 31,810,544 (GRCm39) missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31,798,701 (GRCm39) missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31,828,081 (GRCm39) missense probably benign
R7114:Lamc3 UTSW 2 31,820,657 (GRCm39) missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31,820,714 (GRCm39) missense probably benign 0.39
R7559:Lamc3 UTSW 2 31,812,380 (GRCm39) missense probably benign 0.00
R7714:Lamc3 UTSW 2 31,812,279 (GRCm39) splice site probably null
R7787:Lamc3 UTSW 2 31,790,551 (GRCm39) missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31,811,775 (GRCm39) missense probably benign
R8171:Lamc3 UTSW 2 31,804,983 (GRCm39) missense probably benign 0.06
R8208:Lamc3 UTSW 2 31,777,426 (GRCm39) missense possibly damaging 0.47
R8412:Lamc3 UTSW 2 31,802,128 (GRCm39) missense probably damaging 0.98
R9058:Lamc3 UTSW 2 31,798,653 (GRCm39) missense probably benign 0.01
R9242:Lamc3 UTSW 2 31,788,323 (GRCm39) missense probably benign 0.14
R9269:Lamc3 UTSW 2 31,818,908 (GRCm39) nonsense probably null
R9269:Lamc3 UTSW 2 31,813,017 (GRCm39) missense probably benign 0.11
X0010:Lamc3 UTSW 2 31,828,024 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCCAGGAAGCCACTAAGATGTTC -3'
(R):5'- TACAGGGCCTGGATGGCTACAAAG -3'

Sequencing Primer
(F):5'- cgcacctttaatcccagcac -3'
(R):5'- TGGATGGCTACAAAGCCTGG -3'
Posted On 2014-04-13