Incidental Mutation 'R1515:Tmod4'
ID168206
Institutional Source Beutler Lab
Gene Symbol Tmod4
Ensembl Gene ENSMUSG00000005628
Gene Nametropomodulin 4
SynonymsMTMOD, skeletal tropomodulin, Sk-Tmod
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95124476-95129209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95128679 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 317 (Y317F)
Ref Sequence ENSEMBL: ENSMUSP00000102846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005769] [ENSMUST00000107227] [ENSMUST00000131597] [ENSMUST00000172572] [ENSMUST00000173462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005769
AA Change: Y317F

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005769
Gene: ENSMUSG00000005628
AA Change: Y317F

DomainStartEndE-ValueType
Pfam:Tropomodulin 4 143 2.7e-62 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107227
AA Change: Y317F

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102846
Gene: ENSMUSG00000005628
AA Change: Y317F

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 4.4e-72 PFAM
PDB:1IO0|A 160 343 6e-77 PDB
SCOP:d1a4ya_ 184 289 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130545
Predicted Effect probably benign
Transcript: ENSMUST00000131597
SMART Domains Protein: ENSMUSP00000116341
Gene: ENSMUSG00000005628

DomainStartEndE-ValueType
Pfam:Tropomodulin 1 144 1.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149898
Predicted Effect probably benign
Transcript: ENSMUST00000172572
SMART Domains Protein: ENSMUSP00000134337
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Pfam:zf-SCNM1 44 70 7.6e-19 PFAM
low complexity region 133 148 N/A INTRINSIC
low complexity region 172 179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173462
SMART Domains Protein: ENSMUSP00000133769
Gene: ENSMUSG00000092607

DomainStartEndE-ValueType
Blast:ZnF_C2H2 42 68 2e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199730
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and exhibit no overt myopathy, with normal thin filament lengths, myofibril organization, and skeletal muscle contractile function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Tmod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00851:Tmod4 APN 3 95125580 missense probably damaging 1.00
IGL01339:Tmod4 APN 3 95128297 missense probably benign 0.23
IGL01785:Tmod4 APN 3 95125618 missense probably benign
IGL02160:Tmod4 APN 3 95129113 unclassified probably benign
IGL02303:Tmod4 APN 3 95125642 missense probably benign 0.24
2107:Tmod4 UTSW 3 95130168 unclassified probably null
R0042:Tmod4 UTSW 3 95129788 missense possibly damaging 0.90
R4210:Tmod4 UTSW 3 95127829 missense probably benign 0.00
R4211:Tmod4 UTSW 3 95127829 missense probably benign 0.00
R6093:Tmod4 UTSW 3 95125618 missense probably benign
R6181:Tmod4 UTSW 3 95127807 missense probably damaging 1.00
R6294:Tmod4 UTSW 3 95128306 missense probably benign 0.05
R6351:Tmod4 UTSW 3 95127853 missense probably damaging 1.00
R7417:Tmod4 UTSW 3 95125863 missense possibly damaging 0.87
R7806:Tmod4 UTSW 3 95127604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTAACTTCATCAGCAGCACAGGG -3'
(R):5'- CTAGGGGTACAATCATGCCAAGCTC -3'

Sequencing Primer
(F):5'- GTTCGGGAAAATGCTACTCTCAC -3'
(R):5'- GGAAGGACTTGTCTGTCTCCC -3'
Posted On2014-04-13