Incidental Mutation 'R1515:Bnc2'
ID168208
Institutional Source Beutler Lab
Gene Symbol Bnc2
Ensembl Gene ENSMUSG00000028487
Gene Namebasonuclin 2
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location84275095-84675275 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84414326 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 104 (N104S)
Ref Sequence ENSEMBL: ENSMUSP00000135411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102820] [ENSMUST00000107198] [ENSMUST00000175756] [ENSMUST00000175800] [ENSMUST00000175969] [ENSMUST00000176346] [ENSMUST00000176418] [ENSMUST00000176612] [ENSMUST00000176691] [ENSMUST00000176947]
Predicted Effect probably null
Transcript: ENSMUST00000102820
AA Change: N146S

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099884
Gene: ENSMUSG00000028487
AA Change: N146S

DomainStartEndE-ValueType
low complexity region 362 378 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 469 492 4.72e-2 SMART
ZnF_C2H2 497 526 7.11e0 SMART
low complexity region 612 629 N/A INTRINSIC
low complexity region 633 642 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
ZnF_C2H2 861 884 1.62e0 SMART
ZnF_C2H2 889 916 4.81e0 SMART
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1048 1062 N/A INTRINSIC
ZnF_C2H2 1063 1086 1.03e-2 SMART
ZnF_C2H2 1091 1118 3.78e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107198
AA Change: N118S

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102816
Gene: ENSMUSG00000028487
AA Change: N118S

DomainStartEndE-ValueType
low complexity region 334 350 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
ZnF_C2H2 441 464 4.72e-2 SMART
ZnF_C2H2 469 498 7.11e0 SMART
low complexity region 584 601 N/A INTRINSIC
low complexity region 605 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
ZnF_C2H2 833 856 1.62e0 SMART
ZnF_C2H2 861 888 4.81e0 SMART
low complexity region 963 980 N/A INTRINSIC
low complexity region 1020 1034 N/A INTRINSIC
ZnF_C2H2 1035 1058 1.03e-2 SMART
ZnF_C2H2 1063 1090 3.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123276
Predicted Effect probably null
Transcript: ENSMUST00000175756
AA Change: N37S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175757
Predicted Effect probably null
Transcript: ENSMUST00000175800
AA Change: N40S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134795
Gene: ENSMUSG00000028487
AA Change: N40S

DomainStartEndE-ValueType
low complexity region 256 272 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000175969
AA Change: N57S

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176264
Predicted Effect probably benign
Transcript: ENSMUST00000176346
SMART Domains Protein: ENSMUSP00000134942
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176418
AA Change: N151S

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135569
Gene: ENSMUSG00000028487
AA Change: N151S

DomainStartEndE-ValueType
low complexity region 367 383 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176476
Predicted Effect probably null
Transcript: ENSMUST00000176612
AA Change: N76S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135778
Gene: ENSMUSG00000028487
AA Change: N76S

DomainStartEndE-ValueType
low complexity region 292 308 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
ZnF_C2H2 399 422 4.72e-2 SMART
ZnF_C2H2 427 456 7.11e0 SMART
low complexity region 542 559 N/A INTRINSIC
low complexity region 563 572 N/A INTRINSIC
low complexity region 606 620 N/A INTRINSIC
ZnF_C2H2 791 814 1.62e0 SMART
low complexity region 832 846 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176691
AA Change: N51S

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135375
Gene: ENSMUSG00000028487
AA Change: N51S

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 374 397 4.72e-2 SMART
ZnF_C2H2 402 431 7.11e0 SMART
low complexity region 517 534 N/A INTRINSIC
low complexity region 538 547 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
ZnF_C2H2 766 789 1.62e0 SMART
ZnF_C2H2 794 821 4.81e0 SMART
low complexity region 896 913 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
ZnF_C2H2 968 991 1.03e-2 SMART
ZnF_C2H2 996 1023 3.78e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176947
AA Change: N104S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000177040
AA Change: N36S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177256
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved zinc finger protein. The encoded protein functions in skin color saturation. Mutations in this gene are associated with facial pigmented spots. This gene is also associated with susceptibility to adolescent idiopathic scoliosis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap insertion die within 24 hrs of birth and display cleft palate, an overall size reduction of the head and tongue, and abnormal craniofacial bone development due to impaired multiplication of embryonic craniofacial mesenchymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ece1 T C 4: 137,951,508 V509A probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Bnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Bnc2 APN 4 84276241 unclassified probably null
IGL01902:Bnc2 APN 4 84390944 missense probably damaging 1.00
IGL02228:Bnc2 APN 4 84293076 missense possibly damaging 0.70
IGL02396:Bnc2 APN 4 84276009 missense probably benign 0.16
R0125:Bnc2 UTSW 4 84292932 missense probably damaging 1.00
R0650:Bnc2 UTSW 4 84293196 missense probably benign 0.04
R1082:Bnc2 UTSW 4 84546335 missense probably damaging 1.00
R1334:Bnc2 UTSW 4 84276289 missense possibly damaging 0.49
R1439:Bnc2 UTSW 4 84276068 missense probably benign 0.38
R1447:Bnc2 UTSW 4 84293220 missense probably benign 0.13
R1548:Bnc2 UTSW 4 84275957 missense probably damaging 1.00
R1818:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R1819:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R2345:Bnc2 UTSW 4 84292503 missense probably damaging 1.00
R2897:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2898:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2966:Bnc2 UTSW 4 84293517 missense probably benign 0.14
R3404:Bnc2 UTSW 4 84546241 missense probably damaging 0.98
R4235:Bnc2 UTSW 4 84293514 missense probably damaging 0.96
R4546:Bnc2 UTSW 4 84291976 missense probably benign 0.34
R4676:Bnc2 UTSW 4 84292819 missense probably damaging 1.00
R4926:Bnc2 UTSW 4 84276179 missense probably damaging 1.00
R5060:Bnc2 UTSW 4 84531635 missense probably benign 0.02
R5365:Bnc2 UTSW 4 84411429 intron probably benign
R5735:Bnc2 UTSW 4 84292671 missense probably damaging 1.00
R5872:Bnc2 UTSW 4 84292770 missense possibly damaging 0.86
R5921:Bnc2 UTSW 4 84293055 missense possibly damaging 0.95
R5999:Bnc2 UTSW 4 84555900 missense probably benign 0.20
R6351:Bnc2 UTSW 4 84293143 missense probably benign 0.16
R6869:Bnc2 UTSW 4 84293496 missense probably damaging 1.00
R7236:Bnc2 UTSW 4 84555864 missense probably benign 0.31
R7363:Bnc2 UTSW 4 84292071 missense probably benign 0.02
X0021:Bnc2 UTSW 4 84293140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTGTAGCACCGATGACCGCTC -3'
(R):5'- GGTGATCCAGTGTCCTCTGGAAAAC -3'

Sequencing Primer
(F):5'- ctctctccctctctctgtctc -3'
(R):5'- GTACTCCCTTTGCGTTTAAAGAC -3'
Posted On2014-04-13