Incidental Mutation 'R1515:Grik3'
ID 168210
Institutional Source Beutler Lab
Gene Symbol Grik3
Ensembl Gene ENSMUSG00000001985
Gene Name glutamate receptor, ionotropic, kainate 3
Synonyms Glur7, Glur-7
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 125384493-125607966 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125564521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 501 (N501S)
Ref Sequence ENSEMBL: ENSMUSP00000030676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030676]
AlphaFold B1AS29
Predicted Effect probably benign
Transcript: ENSMUST00000030676
AA Change: N501S

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000030676
Gene: ENSMUSG00000001985
AA Change: N501S

DomainStartEndE-ValueType
Pfam:ANF_receptor 55 398 7.8e-72 PFAM
PBPe 435 802 4.38e-133 SMART
Lig_chan-Glu_bd 445 509 5.77e-34 SMART
transmembrane domain 823 845 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. Transcript variants encoding different isoforms have been described for this gene, however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced short- and long-term synaptic potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ece1 T C 4: 137,678,819 (GRCm39) V509A probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Grik3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Grik3 APN 4 125,526,208 (GRCm39) missense probably benign
IGL01534:Grik3 APN 4 125,579,983 (GRCm39) missense probably damaging 1.00
IGL01538:Grik3 APN 4 125,587,829 (GRCm39) missense possibly damaging 0.90
IGL02276:Grik3 APN 4 125,517,295 (GRCm39) missense possibly damaging 0.86
IGL02323:Grik3 APN 4 125,579,783 (GRCm39) splice site probably benign
IGL02475:Grik3 APN 4 125,544,310 (GRCm39) missense probably benign
IGL03198:Grik3 APN 4 125,553,555 (GRCm39) missense probably benign 0.25
IGL03307:Grik3 APN 4 125,535,347 (GRCm39) missense possibly damaging 0.91
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0054:Grik3 UTSW 4 125,517,368 (GRCm39) missense probably damaging 1.00
R0116:Grik3 UTSW 4 125,564,349 (GRCm39) missense probably benign 0.01
R0208:Grik3 UTSW 4 125,579,958 (GRCm39) missense probably damaging 1.00
R0497:Grik3 UTSW 4 125,517,303 (GRCm39) missense possibly damaging 0.82
R1295:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1296:Grik3 UTSW 4 125,598,357 (GRCm39) splice site probably benign
R1559:Grik3 UTSW 4 125,601,790 (GRCm39) missense probably benign 0.16
R1617:Grik3 UTSW 4 125,584,985 (GRCm39) missense probably benign
R1848:Grik3 UTSW 4 125,587,931 (GRCm39) missense probably damaging 1.00
R2903:Grik3 UTSW 4 125,564,437 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3440:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,764 (GRCm39) missense probably damaging 1.00
R3442:Grik3 UTSW 4 125,587,763 (GRCm39) missense probably damaging 1.00
R3842:Grik3 UTSW 4 125,587,747 (GRCm39) splice site probably benign
R4649:Grik3 UTSW 4 125,544,278 (GRCm39) missense probably damaging 1.00
R4841:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R4842:Grik3 UTSW 4 125,584,969 (GRCm39) missense probably damaging 1.00
R5093:Grik3 UTSW 4 125,564,382 (GRCm39) missense probably benign
R5318:Grik3 UTSW 4 125,587,929 (GRCm39) missense probably damaging 0.96
R5549:Grik3 UTSW 4 125,579,838 (GRCm39) missense possibly damaging 0.95
R6221:Grik3 UTSW 4 125,598,916 (GRCm39) missense probably damaging 0.99
R6226:Grik3 UTSW 4 125,553,582 (GRCm39) missense probably benign 0.04
R6306:Grik3 UTSW 4 125,526,205 (GRCm39) missense probably benign 0.01
R6672:Grik3 UTSW 4 125,517,309 (GRCm39) missense probably benign 0.08
R6682:Grik3 UTSW 4 125,544,259 (GRCm39) missense probably damaging 1.00
R6783:Grik3 UTSW 4 125,526,093 (GRCm39) missense probably benign 0.01
R7390:Grik3 UTSW 4 125,543,532 (GRCm39) missense probably damaging 1.00
R7604:Grik3 UTSW 4 125,517,428 (GRCm39) missense probably damaging 0.97
R7790:Grik3 UTSW 4 125,579,812 (GRCm39) missense probably damaging 1.00
R7822:Grik3 UTSW 4 125,550,190 (GRCm39) critical splice donor site probably null
R7952:Grik3 UTSW 4 125,598,340 (GRCm39) missense probably damaging 1.00
R8418:Grik3 UTSW 4 125,579,835 (GRCm39) missense possibly damaging 0.95
R8769:Grik3 UTSW 4 125,550,166 (GRCm39) missense probably damaging 1.00
R9030:Grik3 UTSW 4 125,526,185 (GRCm39) missense probably benign 0.24
R9243:Grik3 UTSW 4 125,601,690 (GRCm39) missense probably benign 0.00
R9792:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
R9793:Grik3 UTSW 4 125,526,315 (GRCm39) missense probably damaging 0.97
Z1177:Grik3 UTSW 4 125,544,299 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGCCTCAGCCACTTAGCTTAGCAC -3'
(R):5'- GCTCACCAAAGATGCCTTGGGAAG -3'

Sequencing Primer
(F):5'- TCTGTCCCCTCAGGAGGAG -3'
(R):5'- CATCATCAGAGGGGCCAATTTG -3'
Posted On 2014-04-13