Incidental Mutation 'R1515:Ece1'
ID 168211
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Name endothelin converting enzyme 1
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R1515 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 137589548-137692540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137678819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 509 (V509A)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000102518
AA Change: V509A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: V509A

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,336,583 (GRCm39) T401A probably damaging Het
Arhgap32 G T 9: 32,027,498 (GRCm39) V23L probably benign Het
Atmin T A 8: 117,681,579 (GRCm39) C193S possibly damaging Het
Atp13a5 C T 16: 29,152,792 (GRCm39) V225I probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
BC024139 A G 15: 76,008,526 (GRCm39) V350A possibly damaging Het
Birc6 G T 17: 74,835,631 (GRCm39) E29* probably null Het
Bnc2 T C 4: 84,332,563 (GRCm39) N104S probably null Het
C030048H21Rik T C 2: 26,147,515 (GRCm39) probably null Het
Cd320 G T 17: 34,066,613 (GRCm39) C117F probably damaging Het
Cdkal1 A G 13: 29,510,133 (GRCm39) S542P probably damaging Het
Crocc T C 4: 140,747,048 (GRCm39) T1587A probably benign Het
Defb41 T C 1: 18,330,817 (GRCm39) probably null Het
Dmtf1 A G 5: 9,190,384 (GRCm39) probably null Het
Dnhd1 A G 7: 105,353,355 (GRCm39) N2836S probably benign Het
Dpp8 G A 9: 64,986,030 (GRCm39) S840N probably benign Het
Dsc2 A G 18: 20,167,758 (GRCm39) F111L probably damaging Het
Dsc2 T A 18: 20,178,622 (GRCm39) I261F probably benign Het
Ecm2 T C 13: 49,671,808 (GRCm39) M103T possibly damaging Het
Emsy T C 7: 98,240,063 (GRCm39) H1064R probably damaging Het
Engase T C 11: 118,377,966 (GRCm39) V252A possibly damaging Het
F13b A G 1: 139,438,703 (GRCm39) Y369C probably damaging Het
Flii T C 11: 60,612,432 (GRCm39) probably null Het
Fzd10 T A 5: 128,679,623 (GRCm39) F448I probably damaging Het
Gpr35 T G 1: 92,910,770 (GRCm39) F161V probably damaging Het
Gprin2 T C 14: 33,917,230 (GRCm39) D180G possibly damaging Het
Grik3 A G 4: 125,564,521 (GRCm39) N501S probably benign Het
Hells A G 19: 38,956,209 (GRCm39) K802E probably damaging Het
Il1r1 T A 1: 40,332,509 (GRCm39) C96* probably null Het
Kcnk16 T A 14: 20,315,345 (GRCm39) I73F probably damaging Het
Kcnq5 A G 1: 21,472,905 (GRCm39) S652P probably benign Het
Lamc3 A G 2: 31,830,763 (GRCm39) D1500G probably damaging Het
Macf1 A G 4: 123,272,273 (GRCm39) F6468L probably damaging Het
Mgrn1 T A 16: 4,733,644 (GRCm39) F198I probably benign Het
Mmp3 A G 9: 7,451,232 (GRCm39) T323A probably benign Het
N4bp2 A G 5: 65,947,841 (GRCm39) Y157C probably benign Het
Nfkbid C A 7: 30,124,781 (GRCm39) H190Q probably benign Het
Or10a3m T C 7: 108,313,148 (GRCm39) V184A possibly damaging Het
Or5b118 T C 19: 13,449,044 (GRCm39) S237P probably damaging Het
Or6c75 T C 10: 129,337,460 (GRCm39) S236P probably damaging Het
Osgin2 C T 4: 15,998,380 (GRCm39) G414D probably benign Het
Pkd1 G A 17: 24,813,827 (GRCm39) R4097H probably benign Het
Pnkd T A 1: 74,388,968 (GRCm39) L213Q probably null Het
Ppfibp1 A G 6: 146,928,930 (GRCm39) H850R probably benign Het
Ppp6r1 T C 7: 4,646,257 (GRCm39) D148G probably damaging Het
Ptprt A T 2: 162,079,954 (GRCm39) S282T probably damaging Het
Sgsm3 T C 15: 80,894,457 (GRCm39) V536A probably benign Het
Slc22a23 T A 13: 34,387,947 (GRCm39) Q383L probably benign Het
Snx29 T C 16: 11,217,701 (GRCm39) probably null Het
Tmem229b-ps T A 10: 53,351,542 (GRCm39) noncoding transcript Het
Tmod4 A T 3: 95,035,990 (GRCm39) Y317F possibly damaging Het
Trim13 T C 14: 61,843,108 (GRCm39) M375T probably benign Het
Txndc11 A G 16: 10,892,926 (GRCm39) S935P probably damaging Het
Umod T C 7: 119,064,720 (GRCm39) N592D probably benign Het
Vmn2r118 A G 17: 55,917,643 (GRCm39) Y290H probably benign Het
Vps26b A G 9: 26,924,041 (GRCm39) M234T probably damaging Het
Zbtb48 A G 4: 152,104,658 (GRCm39) probably null Het
Zfc3h1 T A 10: 115,252,647 (GRCm39) F1320Y probably benign Het
Zfp784 A T 7: 5,039,039 (GRCm39) probably benign Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137,665,969 (GRCm39) missense probably damaging 1.00
IGL01538:Ece1 APN 4 137,675,855 (GRCm39) missense probably benign
IGL01588:Ece1 APN 4 137,684,517 (GRCm39) splice site probably benign
IGL01678:Ece1 APN 4 137,690,044 (GRCm39) missense probably damaging 1.00
IGL02619:Ece1 APN 4 137,666,044 (GRCm39) missense probably benign 0.08
IGL02936:Ece1 APN 4 137,673,612 (GRCm39) missense probably benign 0.01
IGL02956:Ece1 APN 4 137,690,149 (GRCm39) missense probably damaging 0.99
IGL03332:Ece1 APN 4 137,673,666 (GRCm39) missense probably damaging 0.99
R0063:Ece1 UTSW 4 137,675,892 (GRCm39) missense probably benign 0.14
R0240:Ece1 UTSW 4 137,676,746 (GRCm39) splice site probably benign
R1004:Ece1 UTSW 4 137,653,550 (GRCm39) missense probably benign 0.04
R1541:Ece1 UTSW 4 137,675,971 (GRCm39) splice site probably null
R1796:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1834:Ece1 UTSW 4 137,685,439 (GRCm39) missense probably damaging 0.99
R1834:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1836:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1930:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R1931:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R2065:Ece1 UTSW 4 137,685,393 (GRCm39) missense probably benign 0.04
R2281:Ece1 UTSW 4 137,673,673 (GRCm39) missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137,675,855 (GRCm39) missense probably benign
R4720:Ece1 UTSW 4 137,684,486 (GRCm39) missense probably damaging 1.00
R4773:Ece1 UTSW 4 137,672,464 (GRCm39) missense probably benign 0.00
R5794:Ece1 UTSW 4 137,683,844 (GRCm39) missense probably damaging 0.99
R5969:Ece1 UTSW 4 137,689,051 (GRCm39) critical splice donor site probably null
R6056:Ece1 UTSW 4 137,688,958 (GRCm39) missense probably damaging 1.00
R6332:Ece1 UTSW 4 137,685,319 (GRCm39) missense probably damaging 1.00
R6648:Ece1 UTSW 4 137,648,470 (GRCm39) missense probably benign 0.00
R7285:Ece1 UTSW 4 137,641,074 (GRCm39) splice site probably null
R7387:Ece1 UTSW 4 137,666,095 (GRCm39) missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
R8294:Ece1 UTSW 4 137,675,931 (GRCm39) missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137,664,075 (GRCm39) missense probably damaging 0.99
R8806:Ece1 UTSW 4 137,672,452 (GRCm39) missense probably damaging 1.00
R9578:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
X0063:Ece1 UTSW 4 137,653,686 (GRCm39) missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137,648,338 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAAGGTTCCCAGCCTAACTGTTCTC -3'
(R):5'- GCAAGCAATGAAGCCAAGTGCC -3'

Sequencing Primer
(F):5'- GTttttttcaagacagggtttctc -3'
(R):5'- CAAGTGCCCCCCCCAAC -3'
Posted On 2014-04-13