Incidental Mutation 'R1515:Ece1'
ID168211
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Nameendothelin converting enzyme 1
Synonyms
MMRRC Submission 039562-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R1515 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137862237-137965229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137951508 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 509 (V509A)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
Predicted Effect probably benign
Transcript: ENSMUST00000102518
AA Change: V509A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: V509A

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akt2 A G 7: 27,637,158 T401A probably damaging Het
Arhgap32 G T 9: 32,116,202 V23L probably benign Het
Atmin T A 8: 116,954,840 C193S possibly damaging Het
Atp13a5 C T 16: 29,333,974 V225I probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
BC024139 A G 15: 76,124,326 V350A possibly damaging Het
Birc6 G T 17: 74,528,636 E29* probably null Het
Bnc2 T C 4: 84,414,326 N104S probably null Het
C030048H21Rik T C 2: 26,257,503 probably null Het
Cd320 G T 17: 33,847,639 C117F probably damaging Het
Cdkal1 A G 13: 29,326,150 S542P probably damaging Het
Crocc T C 4: 141,019,737 T1587A probably benign Het
Defb41 T C 1: 18,260,593 probably null Het
Dmtf1 A G 5: 9,140,384 probably null Het
Dnhd1 A G 7: 105,704,148 N2836S probably benign Het
Dpp8 G A 9: 65,078,748 S840N probably benign Het
Dsc2 A G 18: 20,034,701 F111L probably damaging Het
Dsc2 T A 18: 20,045,565 I261F probably benign Het
Ecm2 T C 13: 49,518,332 M103T possibly damaging Het
Emsy T C 7: 98,590,856 H1064R probably damaging Het
Engase T C 11: 118,487,140 V252A possibly damaging Het
F13b A G 1: 139,510,965 Y369C probably damaging Het
Flii T C 11: 60,721,606 probably null Het
Fzd10 T A 5: 128,602,559 F448I probably damaging Het
Gpr35 T G 1: 92,983,048 F161V probably damaging Het
Gprin2 T C 14: 34,195,273 D180G possibly damaging Het
Grik3 A G 4: 125,670,728 N501S probably benign Het
Hells A G 19: 38,967,765 K802E probably damaging Het
Il1r1 T A 1: 40,293,349 C96* probably null Het
Kcnk16 T A 14: 20,265,277 I73F probably damaging Het
Kcnq5 A G 1: 21,402,681 S652P probably benign Het
Lamc3 A G 2: 31,940,751 D1500G probably damaging Het
Macf1 A G 4: 123,378,480 F6468L probably damaging Het
Mgrn1 T A 16: 4,915,780 F198I probably benign Het
Mmp3 A G 9: 7,451,232 T323A probably benign Het
N4bp2 A G 5: 65,790,498 Y157C probably benign Het
Nfkbid C A 7: 30,425,356 H190Q probably benign Het
Olfr1474 T C 19: 13,471,680 S237P probably damaging Het
Olfr512 T C 7: 108,713,941 V184A possibly damaging Het
Olfr790 T C 10: 129,501,591 S236P probably damaging Het
Osgin2 C T 4: 15,998,380 G414D probably benign Het
Pkd1 G A 17: 24,594,853 R4097H probably benign Het
Pnkd T A 1: 74,349,809 L213Q probably null Het
Ppfibp1 A G 6: 147,027,432 H850R probably benign Het
Ppp6r1 T C 7: 4,643,258 D148G probably damaging Het
Ptprt A T 2: 162,238,034 S282T probably damaging Het
Sgsm3 T C 15: 81,010,256 V536A probably benign Het
Slc22a23 T A 13: 34,203,964 Q383L probably benign Het
Snx29 T C 16: 11,399,837 probably null Het
Tmem229b-ps T A 10: 53,475,446 noncoding transcript Het
Tmod4 A T 3: 95,128,679 Y317F possibly damaging Het
Trim13 T C 14: 61,605,659 M375T probably benign Het
Txndc11 A G 16: 11,075,062 S935P probably damaging Het
Umod T C 7: 119,465,497 N592D probably benign Het
Vmn2r118 A G 17: 55,610,643 Y290H probably benign Het
Vps26b A G 9: 27,012,745 M234T probably damaging Het
Zbtb48 A G 4: 152,020,201 probably null Het
Zfc3h1 T A 10: 115,416,742 F1320Y probably benign Het
Zfp784 A T 7: 5,036,040 probably benign Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137938658 missense probably damaging 1.00
IGL01538:Ece1 APN 4 137948544 missense probably benign
IGL01588:Ece1 APN 4 137957206 splice site probably benign
IGL01678:Ece1 APN 4 137962733 missense probably damaging 1.00
IGL02619:Ece1 APN 4 137938733 missense probably benign 0.08
IGL02936:Ece1 APN 4 137946301 missense probably benign 0.01
IGL02956:Ece1 APN 4 137962838 missense probably damaging 0.99
IGL03332:Ece1 APN 4 137946355 missense probably damaging 0.99
R0063:Ece1 UTSW 4 137948581 missense probably benign 0.14
R0240:Ece1 UTSW 4 137949435 splice site probably benign
R1004:Ece1 UTSW 4 137926239 missense probably benign 0.04
R1541:Ece1 UTSW 4 137948660 splice site probably null
R1796:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958128 missense probably damaging 0.99
R1836:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1930:Ece1 UTSW 4 137938763 missense probably benign 0.01
R1931:Ece1 UTSW 4 137938763 missense probably benign 0.01
R2065:Ece1 UTSW 4 137958082 missense probably benign 0.04
R2281:Ece1 UTSW 4 137946362 missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137948544 missense probably benign
R4720:Ece1 UTSW 4 137957175 missense probably damaging 1.00
R4773:Ece1 UTSW 4 137945153 missense probably benign 0.00
R5794:Ece1 UTSW 4 137956533 missense probably damaging 0.99
R5969:Ece1 UTSW 4 137961740 critical splice donor site probably null
R6056:Ece1 UTSW 4 137961647 missense probably damaging 1.00
R6332:Ece1 UTSW 4 137958008 missense probably damaging 1.00
R6648:Ece1 UTSW 4 137921159 missense probably benign 0.00
R7285:Ece1 UTSW 4 137913763 splice site probably null
R7387:Ece1 UTSW 4 137938784 missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137913822 missense probably benign
R8294:Ece1 UTSW 4 137948620 missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137936764 missense probably damaging 0.99
R8806:Ece1 UTSW 4 137945141 missense probably damaging 1.00
X0063:Ece1 UTSW 4 137926375 missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137921027 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GAAGGTTCCCAGCCTAACTGTTCTC -3'
(R):5'- GCAAGCAATGAAGCCAAGTGCC -3'

Sequencing Primer
(F):5'- GTttttttcaagacagggtttctc -3'
(R):5'- CAAGTGCCCCCCCCAAC -3'
Posted On2014-04-13